\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725219323:

Variant ID: vg0725219323 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25219323
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGAAACCAAAATCAACCCCCCAAGGGCATAGGGGACCATATATATGACTACTTATGATAACTATAGTAACCATGTAATACAATATTTAATTCAAACA[T/C]
AGACCCAATACCAAGACATGCATGTTTTGCATTAAAATCTTTACAACAATGTTTCAGGCTATGATGAGAATATTAAATTCTAAAATTAGGCACATGGTAT

Reverse complement sequence

ATACCATGTGCCTAATTTTAGAATTTAATATTCTCATCATAGCCTGAAACATTGTTGTAAAGATTTTAATGCAAAACATGCATGTCTTGGTATTGGGTCT[A/G]
TGTTTGAATTAAATATTGTATTACATGGTTACTATAGTTATCATAAGTAGTCATATATATGGTCCCCTATGCCCTTGGGGGGTTGATTTTGGTTTCCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 25.20% 0.11% 0.00% NA
All Indica  2759 97.40% 2.50% 0.11% 0.00% NA
All Japonica  1512 33.90% 66.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 91.80% 8.00% 0.22% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 61.80% 38.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.50% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725219323 T -> C LOC_Os07g42140.1 upstream_gene_variant ; 2703.0bp to feature; MODIFIER silent_mutation Average:25.826; most accessible tissue: Callus, score: 71.733 N N N N
vg0725219323 T -> C LOC_Os07g42150.1 downstream_gene_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:25.826; most accessible tissue: Callus, score: 71.733 N N N N
vg0725219323 T -> C LOC_Os07g42140-LOC_Os07g42150 intergenic_region ; MODIFIER silent_mutation Average:25.826; most accessible tissue: Callus, score: 71.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725219323 NA 4.01E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 2.06E-06 NA mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 2.06E-06 NA mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 7.63E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 1.89E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 7.22E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 7.27E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 4.97E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 1.64E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 9.45E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 6.99E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 3.92E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 1.16E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323 NA 6.87E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251