\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725044153:

Variant ID: vg0725044153 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25044153
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGCCCGTCCGCCGCCGCTACACATCCTCCTCTGCCCCGACCGTTGCTCTGCCTCCTCCACCTCCACGAGGAGCCCGTCCGCGTCGCTATGCCAGCGCC[A/G]
CCGCTTCGCCTCTTCCACCACCACGAGTAACCCGTCCGCCGCCGCTACACATCCTCCTTCGCTGGCGCCGCCGCTTCGTCTCGTCCACCTCCGCAAGGAG

Reverse complement sequence

CTCCTTGCGGAGGTGGACGAGACGAAGCGGCGGCGCCAGCGAAGGAGGATGTGTAGCGGCGGCGGACGGGTTACTCGTGGTGGTGGAAGAGGCGAAGCGG[T/C]
GGCGCTGGCATAGCGACGCGGACGGGCTCCTCGTGGAGGTGGAGGAGGCAGAGCAACGGTCGGGGCAGAGGAGGATGTGTAGCGGCGGCGGACGGGCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 35.30% 1.95% 3.17% NA
All Indica  2759 88.80% 3.20% 2.57% 5.44% NA
All Japonica  1512 1.60% 97.20% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.10% 1.20% 5.71% 4.03% NA
Indica II  465 85.20% 9.00% 1.08% 4.73% NA
Indica III  913 90.30% 0.20% 1.42% 8.11% NA
Indica Intermediate  786 89.20% 4.60% 2.42% 3.82% NA
Temperate Japonica  767 2.30% 95.40% 2.22% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 96.70% 0.83% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 43.30% 54.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725044153 A -> DEL N N silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41810.1 upstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41820.1 upstream_gene_variant ; 4963.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41810.2 upstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41810.3 upstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41810.4 upstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41800.1 downstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41800.2 downstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41800.3 downstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N
vg0725044153 A -> G LOC_Os07g41800-LOC_Os07g41810 intergenic_region ; MODIFIER silent_mutation Average:84.744; most accessible tissue: Zhenshan97 young leaf, score: 92.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725044153 A G 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725044153 NA 2.27E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725044153 NA 1.05E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 5.07E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.18E-10 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 3.85E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 6.05E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 3.44E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.62E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.94E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 6.96E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 5.95E-18 mr1276 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.99E-19 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 5.39E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 7.95E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.38E-15 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.54E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.34E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.64E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 5.12E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 5.95E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 7.90E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.65E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.68E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.29E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.29E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 3.78E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 9.57E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 4.02E-16 mr1924 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.62E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.54E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.01E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.22E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.94E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 9.97E-06 9.97E-06 mr1169_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.18E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.65E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.79E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.47E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 8.69E-06 1.02E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 9.52E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 8.62E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 1.12E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 7.30E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 3.80E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 7.74E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725044153 NA 2.29E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251