\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724979429:

Variant ID: vg0724979429 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24979429
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTAACTTAAAATTAAAAAAAATATTGACTTATAAGTATAAGCATATGAGAAACGAGGAGTTCGTAAGTTCCTGACAGGAGTAACTTAGTACTATCT[C/T]
CATATTTTAATGTATGACGCCGTTGACTTTTTGTCTAACGTTCTAACGTTTGACCGTTTATCTTATTAAAAAAATATGTAATTATCATTTATTTTATTAT

Reverse complement sequence

ATAATAAAATAAATGATAATTACATATTTTTTTAATAAGATAAACGGTCAAACGTTAGAACGTTAGACAAAAAGTCAACGGCGTCATACATTAAAATATG[G/A]
AGATAGTACTAAGTTACTCCTGTCAGGAACTTACGAACTCCTCGTTTCTCATATGCTTATACTTATAAGTCAATATTTTTTTTAATTTTAAGTTAATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 7.70% 1.63% 0.00% NA
All Indica  2759 84.30% 13.00% 2.72% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.50% 0.70% 4.87% 0.00% NA
Indica II  465 50.10% 44.90% 4.95% 0.00% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 80.40% 16.90% 2.67% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724979429 C -> T LOC_Os07g41680.1 downstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:46.063; most accessible tissue: Callus, score: 85.871 N N N N
vg0724979429 C -> T LOC_Os07g41680.2 downstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:46.063; most accessible tissue: Callus, score: 85.871 N N N N
vg0724979429 C -> T LOC_Os07g41680.3 downstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:46.063; most accessible tissue: Callus, score: 85.871 N N N N
vg0724979429 C -> T LOC_Os07g41680-LOC_Os07g41694 intergenic_region ; MODIFIER silent_mutation Average:46.063; most accessible tissue: Callus, score: 85.871 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724979429 NA 5.99E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 2.22E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 2.90E-07 3.36E-09 mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 7.46E-07 2.63E-07 mr1004_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 8.65E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 7.79E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 5.30E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 6.91E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429 NA 5.88E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251