Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724979429:

Variant ID: vg0724979429 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24979429
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTAACTTAAAATTAAAAAAAATATTGACTTATAAGTATAAGCATATGAGAAACGAGGAGTTCGTAAGTTCCTGACAGGAGTAACTTAGTACTATCT[C/T]
CATATTTTAATGTATGACGCCGTTGACTTTTTGTCTAACGTTCTAACGTTTGACCGTTTATCTTATTAAAAAAATATGTAATTATCATTTATTTTATTAT

Reverse complement sequence

ATAATAAAATAAATGATAATTACATATTTTTTTAATAAGATAAACGGTCAAACGTTAGAACGTTAGACAAAAAGTCAACGGCGTCATACATTAAAATATG[G/A]
AGATAGTACTAAGTTACTCCTGTCAGGAACTTACGAACTCCTCGTTTCTCATATGCTTATACTTATAAGTCAATATTTTTTTTAATTTTAAGTTAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	7.70%	1.63%	0.00%	NA
All Indica	2759	84.30%	13.00%	2.72%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.50%	0.70%	4.87%	0.00%	NA
Indica II	465	50.10%	44.90%	4.95%	0.00%	NA
Indica III	913	98.50%	1.30%	0.22%	0.00%	NA
Indica Intermediate	786	80.40%	16.90%	2.67%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724979429	C -> T	LOC_Os07g41680.1	downstream_gene_variant ; 2847.0bp to feature; MODIFIER	silent_mutation	Average:46.063; most accessible tissue: Callus, score: 85.871	N	N	N	N
vg0724979429	C -> T	LOC_Os07g41680.2	downstream_gene_variant ; 2843.0bp to feature; MODIFIER	silent_mutation	Average:46.063; most accessible tissue: Callus, score: 85.871	N	N	N	N
vg0724979429	C -> T	LOC_Os07g41680.3	downstream_gene_variant ; 2843.0bp to feature; MODIFIER	silent_mutation	Average:46.063; most accessible tissue: Callus, score: 85.871	N	N	N	N
vg0724979429	C -> T	LOC_Os07g41680-LOC_Os07g41694	intergenic_region ; MODIFIER	silent_mutation	Average:46.063; most accessible tissue: Callus, score: 85.871	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724979429	NA	5.99E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	2.22E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	2.90E-07	3.36E-09	mr1004_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	7.46E-07	2.63E-07	mr1004_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	8.65E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	7.79E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	5.30E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	6.91E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724979429	NA	5.88E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251