\
| Variant ID: vg0724979429 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24979429 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
AAAATTAACTTAAAATTAAAAAAAATATTGACTTATAAGTATAAGCATATGAGAAACGAGGAGTTCGTAAGTTCCTGACAGGAGTAACTTAGTACTATCT[C/T]
CATATTTTAATGTATGACGCCGTTGACTTTTTGTCTAACGTTCTAACGTTTGACCGTTTATCTTATTAAAAAAATATGTAATTATCATTTATTTTATTAT
ATAATAAAATAAATGATAATTACATATTTTTTTAATAAGATAAACGGTCAAACGTTAGAACGTTAGACAAAAAGTCAACGGCGTCATACATTAAAATATG[G/A]
AGATAGTACTAAGTTACTCCTGTCAGGAACTTACGAACTCCTCGTTTCTCATATGCTTATACTTATAAGTCAATATTTTTTTTAATTTTAAGTTAATTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 7.70% | 1.63% | 0.00% | NA |
| All Indica | 2759 | 84.30% | 13.00% | 2.72% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 0.70% | 4.87% | 0.00% | NA |
| Indica II | 465 | 50.10% | 44.90% | 4.95% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 80.40% | 16.90% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724979429 | C -> T | LOC_Os07g41680.1 | downstream_gene_variant ; 2847.0bp to feature; MODIFIER | silent_mutation | Average:46.063; most accessible tissue: Callus, score: 85.871 | N | N | N | N |
| vg0724979429 | C -> T | LOC_Os07g41680.2 | downstream_gene_variant ; 2843.0bp to feature; MODIFIER | silent_mutation | Average:46.063; most accessible tissue: Callus, score: 85.871 | N | N | N | N |
| vg0724979429 | C -> T | LOC_Os07g41680.3 | downstream_gene_variant ; 2843.0bp to feature; MODIFIER | silent_mutation | Average:46.063; most accessible tissue: Callus, score: 85.871 | N | N | N | N |
| vg0724979429 | C -> T | LOC_Os07g41680-LOC_Os07g41694 | intergenic_region ; MODIFIER | silent_mutation | Average:46.063; most accessible tissue: Callus, score: 85.871 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724979429 | NA | 5.99E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 2.22E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | 2.90E-07 | 3.36E-09 | mr1004_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | 7.46E-07 | 2.63E-07 | mr1004_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 8.65E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 7.79E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 5.30E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 6.91E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724979429 | NA | 5.88E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |