\
| Variant ID: vg0724745375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24745375 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAAATAGGAATTATGTGAAAGTTATTTGCATGAATTATATTTAGTTCCAAGGAGTTAGATTGGTTTACTAATTTTATGTTCTTTGGTATCATGCATACT[A/G]
CTCTTTTTTTTCCTTTCCTTGTTATTATCTCCATTCAGAATCCTTTATATTTTGGAACGGATGTGGTACATTTTAAGCCCTACCAAATCCCAGAGAGAAC
GTTCTCTCTGGGATTTGGTAGGGCTTAAAATGTACCACATCCGTTCCAAAATATAAAGGATTCTGAATGGAGATAATAACAAGGAAAGGAAAAAAAAGAG[T/C]
AGTATGCATGATACCAAAGAACATAAAATTAGTAAACCAATCTAACTCCTTGGAACTAAATATAATTCATGCAAATAACTTTCACATAATTCCTATTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 11.40% | 7.26% | 1.74% | NA |
| All Indica | 2759 | 79.40% | 5.80% | 11.82% | 2.94% | NA |
| All Japonica | 1512 | 92.50% | 6.60% | 0.86% | 0.00% | NA |
| Aus | 269 | 19.00% | 81.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.20% | 19.30% | 29.24% | 6.22% | NA |
| Indica II | 465 | 88.20% | 0.20% | 9.03% | 2.58% | NA |
| Indica III | 913 | 98.00% | 0.70% | 0.66% | 0.66% | NA |
| Indica Intermediate | 786 | 78.60% | 4.80% | 13.23% | 3.31% | NA |
| Temperate Japonica | 767 | 86.80% | 11.60% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 49.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724745375 | A -> DEL | N | N | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41280.1 | downstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41290.1 | downstream_gene_variant ; 29.0bp to feature; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41300.1 | downstream_gene_variant ; 1772.0bp to feature; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41280.2 | downstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41280.3 | downstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| vg0724745375 | A -> G | LOC_Os07g41290-LOC_Os07g41300 | intergenic_region ; MODIFIER | silent_mutation | Average:45.894; most accessible tissue: Callus, score: 73.345 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724745375 | NA | 1.13E-07 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724745375 | NA | 1.64E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 2.02E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 4.55E-07 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | 2.69E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | 3.62E-06 | 1.77E-10 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.04E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.04E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.65E-06 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | 3.79E-06 | 1.94E-07 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.70E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 2.80E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.38E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.34E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 1.32E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | 1.03E-06 | 6.87E-10 | mr1829_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | 9.80E-06 | 3.22E-07 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 2.37E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724745375 | NA | 7.52E-07 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |