\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724745375:

Variant ID: vg0724745375 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24745375
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATAGGAATTATGTGAAAGTTATTTGCATGAATTATATTTAGTTCCAAGGAGTTAGATTGGTTTACTAATTTTATGTTCTTTGGTATCATGCATACT[A/G]
CTCTTTTTTTTCCTTTCCTTGTTATTATCTCCATTCAGAATCCTTTATATTTTGGAACGGATGTGGTACATTTTAAGCCCTACCAAATCCCAGAGAGAAC

Reverse complement sequence

GTTCTCTCTGGGATTTGGTAGGGCTTAAAATGTACCACATCCGTTCCAAAATATAAAGGATTCTGAATGGAGATAATAACAAGGAAAGGAAAAAAAAGAG[T/C]
AGTATGCATGATACCAAAGAACATAAAATTAGTAAACCAATCTAACTCCTTGGAACTAAATATAATTCATGCAAATAACTTTCACATAATTCCTATTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 11.40% 7.26% 1.74% NA
All Indica  2759 79.40% 5.80% 11.82% 2.94% NA
All Japonica  1512 92.50% 6.60% 0.86% 0.00% NA
Aus  269 19.00% 81.00% 0.00% 0.00% NA
Indica I  595 45.20% 19.30% 29.24% 6.22% NA
Indica II  465 88.20% 0.20% 9.03% 2.58% NA
Indica III  913 98.00% 0.70% 0.66% 0.66% NA
Indica Intermediate  786 78.60% 4.80% 13.23% 3.31% NA
Temperate Japonica  767 86.80% 11.60% 1.56% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 49.00% 2.08% 0.00% NA
Intermediate  90 81.10% 15.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724745375 A -> DEL N N silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41280.1 downstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41290.1 downstream_gene_variant ; 29.0bp to feature; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41300.1 downstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41280.2 downstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41280.3 downstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N
vg0724745375 A -> G LOC_Os07g41290-LOC_Os07g41300 intergenic_region ; MODIFIER silent_mutation Average:45.894; most accessible tissue: Callus, score: 73.345 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724745375 NA 1.13E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724745375 NA 1.64E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 2.02E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 4.55E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 2.69E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 3.62E-06 1.77E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.04E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.04E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.65E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 3.79E-06 1.94E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.70E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 2.80E-07 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.38E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.34E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 1.32E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 1.03E-06 6.87E-10 mr1829_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 9.80E-06 3.22E-07 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 2.37E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375 NA 7.52E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251