Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724745375:

Variant ID: vg0724745375 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24745375
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATAGGAATTATGTGAAAGTTATTTGCATGAATTATATTTAGTTCCAAGGAGTTAGATTGGTTTACTAATTTTATGTTCTTTGGTATCATGCATACT[A/G]
CTCTTTTTTTTCCTTTCCTTGTTATTATCTCCATTCAGAATCCTTTATATTTTGGAACGGATGTGGTACATTTTAAGCCCTACCAAATCCCAGAGAGAAC

Reverse complement sequence

GTTCTCTCTGGGATTTGGTAGGGCTTAAAATGTACCACATCCGTTCCAAAATATAAAGGATTCTGAATGGAGATAATAACAAGGAAAGGAAAAAAAAGAG[T/C]
AGTATGCATGATACCAAAGAACATAAAATTAGTAAACCAATCTAACTCCTTGGAACTAAATATAATTCATGCAAATAACTTTCACATAATTCCTATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	11.40%	7.26%	1.74%	NA
All Indica	2759	79.40%	5.80%	11.82%	2.94%	NA
All Japonica	1512	92.50%	6.60%	0.86%	0.00%	NA
Aus	269	19.00%	81.00%	0.00%	0.00%	NA
Indica I	595	45.20%	19.30%	29.24%	6.22%	NA
Indica II	465	88.20%	0.20%	9.03%	2.58%	NA
Indica III	913	98.00%	0.70%	0.66%	0.66%	NA
Indica Intermediate	786	78.60%	4.80%	13.23%	3.31%	NA
Temperate Japonica	767	86.80%	11.60%	1.56%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	4.60%	0.41%	0.00%	NA
VI/Aromatic	96	49.00%	49.00%	2.08%	0.00%	NA
Intermediate	90	81.10%	15.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724745375	A -> DEL	N	N	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41280.1	downstream_gene_variant ; 3080.0bp to feature; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41290.1	downstream_gene_variant ; 29.0bp to feature; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41300.1	downstream_gene_variant ; 1772.0bp to feature; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41280.2	downstream_gene_variant ; 3080.0bp to feature; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41280.3	downstream_gene_variant ; 3080.0bp to feature; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N
vg0724745375	A -> G	LOC_Os07g41290-LOC_Os07g41300	intergenic_region ; MODIFIER	silent_mutation	Average:45.894; most accessible tissue: Callus, score: 73.345	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724745375	NA	1.13E-07	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724745375	NA	1.64E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	2.02E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	4.55E-07	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	2.69E-06	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	3.62E-06	1.77E-10	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.04E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.04E-06	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.65E-06	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	3.79E-06	1.94E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.70E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	2.80E-07	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.38E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.34E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	1.32E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	1.03E-06	6.87E-10	mr1829_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	9.80E-06	3.22E-07	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	2.37E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724745375	NA	7.52E-07	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251