Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724633083:

Variant ID: vg0724633083 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24633083
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGTGTGTGTTCACATTCACCTATATAGACTTATATGGAGATTCTACGTACTACTCCGTCAAAAAGAATAAAACAATCCTAAATACAAATTTAGACAC[T/A]
CATATGTTCAGGTTTTAATTAGGATTAAGTTTTTTTATGCGATGAAAGGTATGTTTAAAAAACCAATTCTAGGTCCTCATCCGTTGCTTATATTCCCTAA

Reverse complement sequence

TTAGGGAATATAAGCAACGGATGAGGACCTAGAATTGGTTTTTTAAACATACCTTTCATCGCATAAAAAAACTTAATCCTAATTAAAACCTGAACATATG[A/T]
GTGTCTAAATTTGTATTTAGGATTGTTTTATTCTTTTTGACGGAGTAGTACGTAGAATCTCCATATAAGTCTATATAGGTGAATGTGAACACACACTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	10.00%	0.00%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	72.00%	28.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	48.10%	51.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724633083	T -> A	LOC_Os07g41150.1	upstream_gene_variant ; 3351.0bp to feature; MODIFIER	silent_mutation	Average:51.911; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg0724633083	T -> A	LOC_Os07g41160.1	downstream_gene_variant ; 501.0bp to feature; MODIFIER	silent_mutation	Average:51.911; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N
vg0724633083	T -> A	LOC_Os07g41160.2	intron_variant ; MODIFIER	silent_mutation	Average:51.911; most accessible tissue: Minghui63 panicle, score: 90.184	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724633083	NA	9.24E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	1.93E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	6.74E-07	2.07E-14	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	2.00E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	2.46E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	6.85E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	8.53E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	8.81E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	9.88E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	5.36E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	3.43E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	1.46E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	6.89E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	6.90E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	2.77E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	6.42E-08	5.21E-15	mr1902_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724633083	NA	2.84E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251