\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724609231:

Variant ID: vg0724609231 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24609231
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATCCCACCATGTAGACAAGGTTTTGAGTCGCTTTGGATATAGTGACTGCAAGCCAGCTCCTACTCCCTATGATCCCAGCGTGCTATTAAGGAAAAAC[T/C,A]
AAAGAATAGCAAGGGATCAACTGAGATACTCTCAAATCATTGGTTCATTGATGTACTTGGCTAGTGCAACGAGGCCTGACATCTCATTTGCTGTAAGCAA

Reverse complement sequence

TTGCTTACAGCAAATGAGATGTCAGGCCTCGTTGCACTAGCCAAGTACATCAATGAACCAATGATTTGAGAGTATCTCAGTTGATCCCTTGCTATTCTTT[A/G,T]
GTTTTTCCTTAATAGCACGCTGGGATCATAGGGAGTAGGAGCTGGCTTGCAGTCACTATATCCAAAGCGACTCAAAACCTTGTCTACATGGTGGGATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 12.60% 5.06% 0.00% A: 0.02%
All Indica  2759 90.80% 1.90% 7.32% 0.00% NA
All Japonica  1512 68.00% 31.30% 0.66% 0.00% NA
Aus  269 81.80% 8.90% 8.92% 0.00% A: 0.37%
Indica I  595 77.10% 1.50% 21.34% 0.00% NA
Indica II  465 95.10% 3.00% 1.94% 0.00% NA
Indica III  913 97.20% 1.30% 1.53% 0.00% NA
Indica Intermediate  786 91.20% 2.20% 6.62% 0.00% NA
Temperate Japonica  767 44.20% 55.30% 0.52% 0.00% NA
Tropical Japonica  504 97.80% 1.80% 0.40% 0.00% NA
Japonica Intermediate  241 81.30% 17.00% 1.66% 0.00% NA
VI/Aromatic  96 66.70% 32.30% 1.04% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724609231 T -> A LOC_Os07g41110.1 stop_lost&splice_region_variant ; p.Ter1691Lysext*?; HIGH stop_lost Average:13.702; most accessible tissue: Callus, score: 25.36 N N N N
vg0724609231 T -> C LOC_Os07g41110.1 stop_lost&splice_region_variant ; p.Ter1691Glnext*?; HIGH stop_lost Average:13.702; most accessible tissue: Callus, score: 25.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724609231 NA 5.83E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 3.78E-06 3.78E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 5.17E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 6.20E-08 4.96E-11 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 9.80E-09 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 1.11E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 7.05E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 3.03E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 5.71E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 9.67E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 5.77E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 8.52E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 8.03E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 6.62E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 7.69E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 2.16E-06 1.67E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 4.20E-09 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 1.03E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 2.22E-06 1.25E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 NA 8.62E-11 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724609231 7.91E-06 7.90E-06 mr1972_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251