\
| Variant ID: vg0724522889 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 24522889 |
| Reference Allele: GGGAGTATTAGAC | Alternative Allele: AGGAGTATTAGAC,G |
| Primary Allele: GGGAGTATTAGAC | Secondary Allele: AGGAGTATTAGAC |
Inferred Ancestral Allele: Not determined.
GAAACTCCGAAAATTACAGTCTTGGCCTCCAACGGCTAGTTTTTGAGGGGCTCGGGTATATAAACTCCTCCACCCCTCCTTTGAGTTGCTGCTGCTCTTG[GGGAGTATTAGAC/AGGAGTATTAGAC,G]
ACATCCAAAGCCAAATAGCATCCCCATTTCCCTACCTTTGTGGTGCCTCTTTGTGAGGGGGATTTGAGAAGGGGAGAGAGTTGGATTGAGAGAGTGAGGA
TCCTCACTCTCTCAATCCAACTCTCTCCCCTTCTCAAATCCCCCTCACAAAGAGGCACCACAAAGGTAGGGAAATGGGGATGCTATTTGGCTTTGGATGT[GTCTAATACTCCC/GTCTAATACTCCT,C]
CAAGAGCAGCAGCAACTCAAAGGAGGGGTGGAGGAGTTTATATACCCGAGCCCCTCAAAAACTAGCCGTTGGAGGCCAAGACTGTAATTTTCGGAGTTTC
| Populations | Population Size | Frequency of GGGAGTATTAGAC(primary allele) | Frequency of AGGAGTATTAGAC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.90% | 9.50% | 6.54% | 5.06% | G: 0.04% |
| All Indica | 2759 | 84.70% | 9.30% | 5.69% | 0.22% | G: 0.07% |
| All Japonica | 1512 | 83.50% | 0.50% | 1.46% | 14.55% | NA |
| Aus | 269 | 15.60% | 47.60% | 36.80% | 0.00% | NA |
| Indica I | 595 | 70.40% | 14.50% | 15.13% | 0.00% | NA |
| Indica II | 465 | 92.30% | 4.50% | 2.15% | 1.08% | NA |
| Indica III | 913 | 89.00% | 9.30% | 1.53% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 86.10% | 8.10% | 5.47% | 0.13% | G: 0.13% |
| Temperate Japonica | 767 | 71.80% | 0.40% | 2.09% | 25.68% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 90.90% | 2.10% | 2.07% | 4.98% | NA |
| VI/Aromatic | 96 | 18.80% | 49.00% | 22.92% | 9.38% | NA |
| Intermediate | 90 | 75.60% | 10.00% | 10.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724522889 | GGGAGTATTAGAC -> DEL | N | N | silent_mutation | Average:8.3; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0724522889 | GGGAGTATTAGAC -> AGGAGTATTAGAC | LOC_Os07g40986.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.3; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0724522889 | GGGAGTATTAGAC -> AGGAGTATTAGAC | LOC_Os07g40986.2 | intron_variant ; MODIFIER | silent_mutation | Average:8.3; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0724522889 | GGGAGTATTAGAC -> G | LOC_Os07g40986.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.3; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0724522889 | GGGAGTATTAGAC -> G | LOC_Os07g40986.2 | intron_variant ; MODIFIER | silent_mutation | Average:8.3; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724522889 | 2.00E-09 | 7.30E-12 | mr1138 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 1.12E-12 | 1.12E-12 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 7.68E-09 | 2.15E-08 | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 1.44E-20 | 1.88E-26 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 4.58E-11 | 2.43E-16 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 5.07E-11 | 5.73E-14 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 4.59E-08 | 6.41E-10 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 9.12E-08 | 9.12E-08 | mr1181_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 5.28E-11 | 1.67E-11 | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 1.66E-23 | 5.37E-31 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | NA | 3.04E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 2.59E-08 | 2.97E-11 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | NA | 2.53E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 2.53E-06 | 3.16E-08 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 9.29E-07 | NA | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 7.08E-06 | 7.08E-06 | mr1714_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 2.69E-08 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 4.08E-13 | 1.63E-23 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 2.57E-08 | NA | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724522889 | 1.95E-13 | 5.65E-24 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |