\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724510628:

Variant ID: vg0724510628 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24510628
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCTCCCCCCGCTCGCCCCTCCCACCACGTGCGCACCTGTTGGGCCCACCTACTTCTCCCCCCCTTTTTCCACAAAAGATGTTTCACCTAGTGTACTTA[T/C]
AATGTTTCACTATTTATAGATCTAATGTTGCGGTGAATTAAAATATTCTTTTGTAACAAAAACCCACATATTTTGGAAGCTCTCTATTAAGAGAATTTGG

Reverse complement sequence

CCAAATTCTCTTAATAGAGAGCTTCCAAAATATGTGGGTTTTTGTTACAAAAGAATATTTTAATTCACCGCAACATTAGATCTATAAATAGTGAAACATT[A/G]
TAAGTACACTAGGTGAAACATCTTTTGTGGAAAAAGGGGGGGAGAAGTAGGTGGGCCCAACAGGTGCGCACGTGGTGGGAGGGGCGAGCGGGGGGAGCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 15.60% 41.58% 9.48% NA
All Indica  2759 9.00% 19.20% 64.73% 7.14% NA
All Japonica  1512 83.90% 0.70% 1.06% 14.35% NA
Aus  269 3.70% 58.40% 37.55% 0.37% NA
Indica I  595 7.40% 14.50% 71.60% 6.55% NA
Indica II  465 14.20% 12.30% 64.73% 8.82% NA
Indica III  913 6.20% 26.10% 60.79% 6.90% NA
Indica Intermediate  786 10.20% 18.80% 64.12% 6.87% NA
Temperate Japonica  767 71.10% 0.30% 1.83% 26.86% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 91.70% 3.30% 0.83% 4.15% NA
VI/Aromatic  96 9.40% 33.30% 29.17% 28.12% NA
Intermediate  90 48.90% 6.70% 37.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724510628 T -> DEL N N silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N
vg0724510628 T -> C LOC_Os07g40940.1 downstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N
vg0724510628 T -> C LOC_Os07g40950.1 downstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N
vg0724510628 T -> C LOC_Os07g40974.1 downstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N
vg0724510628 T -> C LOC_Os07g40974.2 downstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N
vg0724510628 T -> C LOC_Os07g40940-LOC_Os07g40950 intergenic_region ; MODIFIER silent_mutation Average:14.834; most accessible tissue: Callus, score: 47.083 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724510628 NA 4.76E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724510628 8.89E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 2.69E-10 4.14E-13 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 2.45E-14 2.45E-14 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 9.89E-19 2.75E-17 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 3.23E-26 5.28E-34 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.46E-12 5.86E-08 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 3.12E-20 3.38E-25 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 3.24E-06 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 4.83E-12 1.05E-14 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 NA 6.56E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 4.99E-11 2.49E-13 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.52E-10 1.52E-10 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 4.55E-18 4.33E-17 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.61E-44 1.72E-53 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.04E-06 1.92E-12 mr1567_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 5.94E-10 2.36E-13 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 NA 9.63E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 NA 4.14E-08 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.29E-07 1.30E-09 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 5.65E-09 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 6.49E-07 6.49E-07 mr1714_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.38E-16 3.99E-09 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.98E-26 1.29E-34 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 NA 4.24E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 1.62E-15 NA mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724510628 3.28E-25 4.90E-35 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251