\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724492608:

Variant ID: vg0724492608 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24492608
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATGGAAGGAAGAAACTTGTGGGCTGTTGTACTTGTGCCCACATTTCTCCAAGTCAATTATTCGAGTTACTGCGGAGTGGAGAAACATTCTGAATGATG[C/T]
ATATCGTTGTTGCTGCTGCTTCAGAATTGGACAAACATAAATGAAGAAGTTTATGGCAACTTTGATTGAGAATGAAGAGATTCGATCAGATGAGGTTTTC

Reverse complement sequence

GAAAACCTCATCTGATCGAATCTCTTCATTCTCAATCAAAGTTGCCATAAACTTCTTCATTTATGTTTGTCCAATTCTGAAGCAGCAGCAACAACGATAT[G/A]
CATCATTCAGAATGTTTCTCCACTCCGCAGTAACTCGAATAATTGACTTGGAGAAATGTGGGCACAAGTACAACAGCCCACAAGTTTCTTCCTTCCATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 30.30% 0.02% 0.70% NA
All Indica  2759 96.40% 3.40% 0.00% 0.14% NA
All Japonica  1512 33.40% 65.10% 0.07% 1.39% NA
Aus  269 16.40% 83.30% 0.00% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.90% 9.70% 0.00% 0.43% NA
Indica III  913 98.80% 1.10% 0.00% 0.11% NA
Indica Intermediate  786 95.00% 4.80% 0.00% 0.13% NA
Temperate Japonica  767 60.60% 39.10% 0.00% 0.26% NA
Tropical Japonica  504 1.00% 95.40% 0.20% 3.37% NA
Japonica Intermediate  241 14.50% 84.60% 0.00% 0.83% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 43.30% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724492608 C -> DEL N N silent_mutation Average:59.518; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0724492608 C -> T LOC_Os07g40910.1 upstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:59.518; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0724492608 C -> T LOC_Os07g40920.1 downstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:59.518; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0724492608 C -> T LOC_Os07g40930.1 downstream_gene_variant ; 1094.0bp to feature; MODIFIER silent_mutation Average:59.518; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0724492608 C -> T LOC_Os07g40920-LOC_Os07g40930 intergenic_region ; MODIFIER silent_mutation Average:59.518; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724492608 NA 3.09E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 5.65E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 4.00E-06 NA mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 5.42E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 2.81E-06 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 9.21E-14 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 2.41E-12 2.45E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 1.44E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 9.93E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 1.08E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.15E-08 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 3.84E-10 NA mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 5.70E-07 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 4.18E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 3.75E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 1.69E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.33E-22 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.30E-21 2.19E-08 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 1.14E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.29E-07 9.58E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.89E-07 NA mr1567_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 7.07E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 6.42E-08 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 3.65E-07 NA mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 8.84E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 NA 6.54E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 3.78E-15 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 1.03E-13 8.39E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 9.70E-15 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724492608 2.41E-13 1.95E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251