Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724465513:

Variant ID: vg0724465513 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 24465513
Reference Allele: A	Alternative Allele: G,AAG,AG
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCTATAGAACTGTACACACATATATACGTACGTAGAATCATAACGTATTTATCTTATAGATATATAACGTATTTGGCAATGCGATGAGTATAAAAAAA[A/G,AAG,AG]
TATAGATTGGCTAGGTGGAGTGTGCTCTGCAAGCCAAAGAAATGTGGGGGGCTAGGAATCCAGGACTTAGAGACTCAAAATAAGTGTATGCTTAGTAAAT

Reverse complement sequence

ATTTACTAAGCATACACTTATTTTGAGTCTCTAAGTCCTGGATTCCTAGCCCCCCACATTTCTTTGGCTTGCAGAGCACACTCCACCTAGCCAATCTATA[T/C,CTT,CT]
TTTTTTTATACTCATCGCATTGCCAAATACGTTATATATCTATAAGATAAATACGTTATGATTCTACGTACGTATATATGTGTGTACAGTTCTATAGACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	22.10%	4.66%	0.78%	AG: 2.75%; AAG: 0.02%
All Indica	2759	96.60%	2.30%	0.54%	0.43%	AG: 0.14%
All Japonica	1512	34.70%	45.00%	11.31%	1.65%	AG: 7.41%
Aus	269	17.10%	81.80%	1.12%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	90.30%	5.20%	1.94%	2.15%	AG: 0.43%
Indica III	913	98.80%	1.00%	0.22%	0.00%	NA
Indica Intermediate	786	95.40%	3.70%	0.38%	0.25%	AG: 0.25%
Temperate Japonica	767	61.80%	6.40%	19.04%	1.30%	AG: 11.47%
Tropical Japonica	504	2.60%	96.00%	0.60%	0.79%	NA
Japonica Intermediate	241	15.40%	61.00%	9.13%	4.56%	AG: 9.96%
VI/Aromatic	96	7.30%	53.10%	28.12%	0.00%	AG: 11.46%
Intermediate	90	55.60%	35.60%	4.44%	0.00%	AG: 3.33%; AAG: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724465513	A -> AG	LOC_Os07g40820.1	upstream_gene_variant ; 3078.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AG	LOC_Os07g40830.1	downstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AG	LOC_Os07g40840.1	downstream_gene_variant ; 3231.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AG	LOC_Os07g40850.1	downstream_gene_variant ; 4590.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AG	LOC_Os07g40820-LOC_Os07g40830	intergenic_region ; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> DEL	N	N	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AAG	LOC_Os07g40820.1	upstream_gene_variant ; 3078.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AAG	LOC_Os07g40830.1	downstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AAG	LOC_Os07g40840.1	downstream_gene_variant ; 3231.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AAG	LOC_Os07g40850.1	downstream_gene_variant ; 4590.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> AAG	LOC_Os07g40820-LOC_Os07g40830	intergenic_region ; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> G	LOC_Os07g40820.1	upstream_gene_variant ; 3077.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> G	LOC_Os07g40830.1	downstream_gene_variant ; 1186.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> G	LOC_Os07g40840.1	downstream_gene_variant ; 3232.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> G	LOC_Os07g40850.1	downstream_gene_variant ; 4591.0bp to feature; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N
vg0724465513	A -> G	LOC_Os07g40820-LOC_Os07g40830	intergenic_region ; MODIFIER	silent_mutation	Average:46.037; most accessible tissue: Callus, score: 85.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724465513	NA	8.35E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724465513	NA	1.46E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.45E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.01E-11	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.86E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.15E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.35E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.07E-13	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	6.30E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	6.18E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	5.85E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.01E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.59E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.61E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.47E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.39E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.58E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	9.45E-14	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.09E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.29E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.34E-06	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.10E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.14E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.16E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.42E-17	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.66E-09	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	5.86E-09	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.28E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.61E-09	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.26E-20	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.60E-09	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.98E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.71E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.76E-12	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.50E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	8.60E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.74E-09	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	9.81E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	6.53E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	5.02E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	8.99E-10	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.37E-07	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.54E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	9.67E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.11E-07	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.00E-11	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.74E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.55E-10	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.88E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.05E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.78E-19	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.86E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.66E-16	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	5.90E-11	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	5.43E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	8.16E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.12E-14	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	7.92E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.88E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	5.17E-07	NA	mr1699_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.79E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.39E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.57E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	4.32E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.39E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.50E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.70E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.18E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	3.21E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.47E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.70E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	1.21E-09	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513	NA	2.44E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251