\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724465513:

Variant ID: vg0724465513 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24465513
Reference Allele: AAlternative Allele: G,AAG,AG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCTATAGAACTGTACACACATATATACGTACGTAGAATCATAACGTATTTATCTTATAGATATATAACGTATTTGGCAATGCGATGAGTATAAAAAAA[A/G,AAG,AG]
TATAGATTGGCTAGGTGGAGTGTGCTCTGCAAGCCAAAGAAATGTGGGGGGCTAGGAATCCAGGACTTAGAGACTCAAAATAAGTGTATGCTTAGTAAAT

Reverse complement sequence

ATTTACTAAGCATACACTTATTTTGAGTCTCTAAGTCCTGGATTCCTAGCCCCCCACATTTCTTTGGCTTGCAGAGCACACTCCACCTAGCCAATCTATA[T/C,CTT,CT]
TTTTTTTATACTCATCGCATTGCCAAATACGTTATATATCTATAAGATAAATACGTTATGATTCTACGTACGTATATATGTGTGTACAGTTCTATAGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 22.10% 4.66% 0.78% AG: 2.75%; AAG: 0.02%
All Indica  2759 96.60% 2.30% 0.54% 0.43% AG: 0.14%
All Japonica  1512 34.70% 45.00% 11.31% 1.65% AG: 7.41%
Aus  269 17.10% 81.80% 1.12% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 90.30% 5.20% 1.94% 2.15% AG: 0.43%
Indica III  913 98.80% 1.00% 0.22% 0.00% NA
Indica Intermediate  786 95.40% 3.70% 0.38% 0.25% AG: 0.25%
Temperate Japonica  767 61.80% 6.40% 19.04% 1.30% AG: 11.47%
Tropical Japonica  504 2.60% 96.00% 0.60% 0.79% NA
Japonica Intermediate  241 15.40% 61.00% 9.13% 4.56% AG: 9.96%
VI/Aromatic  96 7.30% 53.10% 28.12% 0.00% AG: 11.46%
Intermediate  90 55.60% 35.60% 4.44% 0.00% AG: 3.33%; AAG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724465513 A -> AG LOC_Os07g40820.1 upstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AG LOC_Os07g40830.1 downstream_gene_variant ; 1185.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AG LOC_Os07g40840.1 downstream_gene_variant ; 3231.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AG LOC_Os07g40850.1 downstream_gene_variant ; 4590.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AG LOC_Os07g40820-LOC_Os07g40830 intergenic_region ; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> DEL N N silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AAG LOC_Os07g40820.1 upstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AAG LOC_Os07g40830.1 downstream_gene_variant ; 1185.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AAG LOC_Os07g40840.1 downstream_gene_variant ; 3231.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AAG LOC_Os07g40850.1 downstream_gene_variant ; 4590.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> AAG LOC_Os07g40820-LOC_Os07g40830 intergenic_region ; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> G LOC_Os07g40820.1 upstream_gene_variant ; 3077.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> G LOC_Os07g40830.1 downstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> G LOC_Os07g40840.1 downstream_gene_variant ; 3232.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> G LOC_Os07g40850.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N
vg0724465513 A -> G LOC_Os07g40820-LOC_Os07g40830 intergenic_region ; MODIFIER silent_mutation Average:46.037; most accessible tissue: Callus, score: 85.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724465513 NA 8.35E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724465513 NA 1.46E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.45E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.01E-11 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.86E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.15E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.35E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.07E-13 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 6.30E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 6.18E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 5.85E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.01E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.59E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.61E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.47E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.39E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.58E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 9.45E-14 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.09E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.29E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.34E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.10E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.14E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.16E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.42E-17 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.66E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 5.86E-09 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.28E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.61E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.26E-20 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.60E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.98E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.71E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.76E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.50E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 8.60E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.74E-09 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 9.81E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 6.53E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 5.02E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 8.99E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.37E-07 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.54E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 9.67E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.11E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.00E-11 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.74E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.55E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.88E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.05E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.78E-19 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.86E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.66E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 5.90E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 5.43E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 8.16E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.12E-14 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 7.92E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.88E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 5.17E-07 NA mr1699_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.79E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.39E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.57E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 4.32E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.39E-11 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.50E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.70E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.18E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 3.21E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.47E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.70E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 1.21E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465513 NA 2.44E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251