\
| Variant ID: vg0724424690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24424690 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.41, others allele: 0.00, population size: 88. )
TCTTGGAGAAGACTAGCATCGGACCGACCGCCGCTAAGCTAACAACGGAAACAACCAAGATCGCCCAAAACCCTATCCTTACAAACAACATAAAGCCCAA[T/C]
TCATCCACGTCTTCAGGATCTAGGGAGAAAGGGTGGGAGAGAAGATGGAACACCTCTCCCCCTAGGCCCTCCGCCGTGGCCAACTTGTTGAAACTAGGAC
GTCCTAGTTTCAACAAGTTGGCCACGGCGGAGGGCCTAGGGGGAGAGGTGTTCCATCTTCTCTCCCACCCTTTCTCCCTAGATCCTGAAGACGTGGATGA[A/G]
TTGGGCTTTATGTTGTTTGTAAGGATAGGGTTTTGGGCGATCTTGGTTGTTTCCGTTGTTAGCTTAGCGGCGGTCGGTCCGATGCTAGTCTTCTCCAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 67.50% | 32.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724424690 | T -> C | LOC_Os07g40750.1 | upstream_gene_variant ; 2358.0bp to feature; MODIFIER | silent_mutation | Average:51.659; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0724424690 | T -> C | LOC_Os07g40770.1 | downstream_gene_variant ; 4497.0bp to feature; MODIFIER | silent_mutation | Average:51.659; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0724424690 | T -> C | LOC_Os07g40760.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.659; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724424690 | NA | 8.66E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.88E-08 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.03E-21 | 1.56E-14 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 9.92E-15 | 1.38E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 4.53E-06 | 4.51E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 6.85E-12 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 3.82E-11 | NA | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 5.06E-07 | NA | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 4.24E-07 | NA | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 6.47E-09 | NA | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 2.24E-37 | 1.66E-16 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 4.55E-25 | 3.07E-08 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | NA | 1.30E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 8.51E-08 | NA | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.52E-06 | NA | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.62E-10 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.64E-06 | NA | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 7.00E-21 | NA | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.05E-14 | 1.59E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 1.39E-19 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724424690 | 6.12E-14 | 5.10E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |