\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724405048:

Variant ID: vg0724405048 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24405048
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGCATTTTACATGAGAGCATGCAACCATTGCTATTCTGTATGACTATTGTGCACATGAATAAAGTATTATTGTTGAAAACAAGGTTTTGGAGCCTACA[T/G]
AATGCTGAAGTTTGGGCACACTGTTAAAGCATGTTACTGTTTACAACACTAATAAATTAGACTTATATGAATATTAAACTGCCTGAGGCATTGTAAGGGG

Reverse complement sequence

CCCCTTACAATGCCTCAGGCAGTTTAATATTCATATAAGTCTAATTTATTAGTGTTGTAAACAGTAACATGCTTTAACAGTGTGCCCAAACTTCAGCATT[A/C]
TGTAGGCTCCAAAACCTTGTTTTCAACAATAATACTTTATTCATGTGCACAATAGTCATACAGAATAGCAATGGTTGCATGCTCTCATGTAAAATGCTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.20% 0.02% 0.23% NA
All Indica  2759 97.50% 2.30% 0.00% 0.14% NA
All Japonica  1512 33.60% 66.10% 0.07% 0.20% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.90% 9.70% 0.00% 0.43% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 97.80% 2.00% 0.00% 0.13% NA
Temperate Japonica  767 60.90% 39.10% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 98.80% 0.00% 0.40% NA
Japonica Intermediate  241 15.40% 83.80% 0.41% 0.41% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 57.80% 37.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724405048 T -> DEL N N silent_mutation Average:42.316; most accessible tissue: Callus, score: 83.122 N N N N
vg0724405048 T -> G LOC_Os07g40710.1 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:42.316; most accessible tissue: Callus, score: 83.122 N N N N
vg0724405048 T -> G LOC_Os07g40730.1 intron_variant ; MODIFIER silent_mutation Average:42.316; most accessible tissue: Callus, score: 83.122 N N N N
vg0724405048 T -> G LOC_Os07g40730.2 intron_variant ; MODIFIER silent_mutation Average:42.316; most accessible tissue: Callus, score: 83.122 N N N N
vg0724405048 T -> G LOC_Os07g40730.3 intron_variant ; MODIFIER silent_mutation Average:42.316; most accessible tissue: Callus, score: 83.122 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724405048 4.95E-07 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 3.67E-14 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 6.57E-14 1.95E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 5.98E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 3.31E-12 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.53E-10 NA mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.75E-06 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 8.44E-07 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 4.44E-21 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.92E-21 2.75E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 5.37E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 5.43E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 2.21E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.29E-08 NA mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 4.28E-06 NA mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 4.55E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 2.47E-09 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 8.67E-07 NA mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 NA 6.38E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.55E-20 4.31E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 2.22E-14 1.28E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 8.10E-06 NA mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 1.21E-17 2.27E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048 9.27E-13 NA mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251