Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724405048:

Variant ID: vg0724405048 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24405048
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGCATTTTACATGAGAGCATGCAACCATTGCTATTCTGTATGACTATTGTGCACATGAATAAAGTATTATTGTTGAAAACAAGGTTTTGGAGCCTACA[T/G]
AATGCTGAAGTTTGGGCACACTGTTAAAGCATGTTACTGTTTACAACACTAATAAATTAGACTTATATGAATATTAAACTGCCTGAGGCATTGTAAGGGG

Reverse complement sequence

CCCCTTACAATGCCTCAGGCAGTTTAATATTCATATAAGTCTAATTTATTAGTGTTGTAAACAGTAACATGCTTTAACAGTGTGCCCAAACTTCAGCATT[A/C]
TGTAGGCTCCAAAACCTTGTTTTCAACAATAATACTTTATTCATGTGCACAATAGTCATACAGAATAGCAATGGTTGCATGCTCTCATGTAAAATGCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	24.20%	0.02%	0.23%	NA
All Indica	2759	97.50%	2.30%	0.00%	0.14%	NA
All Japonica	1512	33.60%	66.10%	0.07%	0.20%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	89.90%	9.70%	0.00%	0.43%	NA
Indica III	913	99.70%	0.20%	0.00%	0.11%	NA
Indica Intermediate	786	97.80%	2.00%	0.00%	0.13%	NA
Temperate Japonica	767	60.90%	39.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	98.80%	0.00%	0.40%	NA
Japonica Intermediate	241	15.40%	83.80%	0.41%	0.41%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	37.80%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724405048	T -> DEL	N	N	silent_mutation	Average:42.316; most accessible tissue: Callus, score: 83.122	N	N	N	N
vg0724405048	T -> G	LOC_Os07g40710.1	downstream_gene_variant ; 4260.0bp to feature; MODIFIER	silent_mutation	Average:42.316; most accessible tissue: Callus, score: 83.122	N	N	N	N
vg0724405048	T -> G	LOC_Os07g40730.1	intron_variant ; MODIFIER	silent_mutation	Average:42.316; most accessible tissue: Callus, score: 83.122	N	N	N	N
vg0724405048	T -> G	LOC_Os07g40730.2	intron_variant ; MODIFIER	silent_mutation	Average:42.316; most accessible tissue: Callus, score: 83.122	N	N	N	N
vg0724405048	T -> G	LOC_Os07g40730.3	intron_variant ; MODIFIER	silent_mutation	Average:42.316; most accessible tissue: Callus, score: 83.122	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724405048	4.95E-07	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	3.67E-14	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	6.57E-14	1.95E-07	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	5.98E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	3.31E-12	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.53E-10	NA	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.75E-06	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	8.44E-07	NA	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	4.44E-21	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.92E-21	2.75E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	5.37E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	5.43E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	2.21E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.29E-08	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	4.28E-06	NA	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	4.55E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	2.47E-09	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	8.67E-07	NA	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	NA	6.38E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.55E-20	4.31E-10	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	2.22E-14	1.28E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	8.10E-06	NA	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	1.21E-17	2.27E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724405048	9.27E-13	NA	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251