Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724353613:

Variant ID: vg0724353613 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24353613
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAATTTGAATTTGGATGAAACTCATCGAAATCTCAGACGGCTTCTACTTTCGAGCCTCGTCGAAACCTCAAAATTTCACAGAATTCGACCGGTTTTC[G/A]
TCGGAATTGTGAACCTTAATCCCATCCTACACCCAGGATAACTTATTTTGGAATAGAGAAAGTAGTTACGATTCGACTTATCTCATCATTTGCCCTATAA

Reverse complement sequence

TTATAGGGCAAATGATGAGATAAGTCGAATCGTAACTACTTTCTCTATTCCAAAATAAGTTATCCTGGGTGTAGGATGGGATTAAGGTTCACAATTCCGA[C/T]
GAAAACCGGTCGAATTCTGTGAAATTTTGAGGTTTCGACGAGGCTCGAAAGTAGAAGCCGTCTGAGATTTCGATGAGTTTCATCCAAATTCAAATTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	3.60%	0.06%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	43.90%	55.40%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.20%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724353613	G -> A	LOC_Os07g40630.1	upstream_gene_variant ; 1686.0bp to feature; MODIFIER	silent_mutation	Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0724353613	G -> A	LOC_Os07g40640.1	downstream_gene_variant ; 2106.0bp to feature; MODIFIER	silent_mutation	Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0724353613	G -> A	LOC_Os07g40630-LOC_Os07g40640	intergenic_region ; MODIFIER	silent_mutation	Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724353613	NA	6.43E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	5.98E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	4.60E-40	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	1.29E-08	1.08E-53	mr1550	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	1.97E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	1.78E-38	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	2.37E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	3.12E-36	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	3.93E-50	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724353613	NA	3.71E-28	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251