| Variant ID: vg0724353613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24353613 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCAAATTTGAATTTGGATGAAACTCATCGAAATCTCAGACGGCTTCTACTTTCGAGCCTCGTCGAAACCTCAAAATTTCACAGAATTCGACCGGTTTTC[G/A]
TCGGAATTGTGAACCTTAATCCCATCCTACACCCAGGATAACTTATTTTGGAATAGAGAAAGTAGTTACGATTCGACTTATCTCATCATTTGCCCTATAA
TTATAGGGCAAATGATGAGATAAGTCGAATCGTAACTACTTTCTCTATTCCAAAATAAGTTATCCTGGGTGTAGGATGGGATTAAGGTTCACAATTCCGA[C/T]
GAAAACCGGTCGAATTCTGTGAAATTTTGAGGTTTCGACGAGGCTCGAAAGTAGAAGCCGTCTGAGATTTCGATGAGTTTCATCCAAATTCAAATTTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 3.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.90% | 55.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724353613 | G -> A | LOC_Os07g40630.1 | upstream_gene_variant ; 1686.0bp to feature; MODIFIER | silent_mutation | Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0724353613 | G -> A | LOC_Os07g40640.1 | downstream_gene_variant ; 2106.0bp to feature; MODIFIER | silent_mutation | Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0724353613 | G -> A | LOC_Os07g40630-LOC_Os07g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:34.81; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724353613 | NA | 6.43E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 5.98E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 4.60E-40 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | 1.29E-08 | 1.08E-53 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 1.97E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 1.78E-38 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 2.37E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 3.12E-36 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 3.93E-50 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724353613 | NA | 3.71E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |