Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724316306:

Variant ID: vg0724316306 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24316306
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

AACCCTCTGCTATTACTTTCTAACTAGATCTAATTGTAAAAAGATCGATGTACCGAAATGGAAACCAAACTTTTTTTAAAGGAGTGATAAGCAGCACATA[T/A]
AACAAAGCGGCTGAAGGGAAATAAATTAAACAATAGTGTGAGTGGGATTGAAGTGTGTGCAACGGAGAAAGCAACATGGATTTGAAATGCAAGAAGCTAA

Reverse complement sequence

TTAGCTTCTTGCATTTCAAATCCATGTTGCTTTCTCCGTTGCACACACTTCAATCCCACTCACACTATTGTTTAATTTATTTCCCTTCAGCCGCTTTGTT[A/T]
TATGTGCTGCTTATCACTCCTTTAAAAAAAGTTTGGTTTCCATTTCGGTACATCGATCTTTTTACAATTAGATCTAGTTAGAAAGTAATAGCAGAGGGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	11.20%	0.00%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	68.30%	31.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.90%	0.00%	0.00%	NA
Temperate Japonica	767	40.40%	59.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724316306	T -> A	LOC_Os07g40570.1	upstream_gene_variant ; 923.0bp to feature; MODIFIER	silent_mutation	Average:70.603; most accessible tissue: Callus, score: 93.959	N	N	N	N
vg0724316306	T -> A	LOC_Os07g40580.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:70.603; most accessible tissue: Callus, score: 93.959	N	N	N	N
vg0724316306	T -> A	LOC_Os07g40570-LOC_Os07g40580	intergenic_region ; MODIFIER	silent_mutation	Average:70.603; most accessible tissue: Callus, score: 93.959	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724316306	8.63E-08	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	7.98E-18	1.44E-12	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	1.01E-13	6.76E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	1.80E-11	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	5.12E-11	NA	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	3.75E-07	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	6.13E-07	NA	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	9.55E-08	NA	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	1.05E-28	1.72E-12	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	1.19E-22	2.23E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	3.54E-07	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	3.33E-12	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	2.77E-07	NA	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	2.13E-18	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	9.48E-14	5.39E-07	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	3.15E-17	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	5.34E-13	NA	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724316306	NA	1.83E-13	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251