\
| Variant ID: vg0724166441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24166441 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 113. )
CCCTTTGTGAGTTCGGCCGGAGGCAGCGGGTGAGATTCGAGGGCTTGGTGAGCGGAGCTGTGTGATCTTGAGGGGGGTTAGCCCCCCCAAGACGATGAGA[A/C]
AAAAGAGGTTTATACAGATTCGGGCCGCTAAGAAGCGTAATACCCTACTCCTGTGCATGATTGATTGAATGTAGAACACAAGTGTTTGGGGTTGCGAGAC
GTCTCGCAACCCCAAACACTTGTGTTCTACATTCAATCAATCATGCACAGGAGTAGGGTATTACGCTTCTTAGCGGCCCGAATCTGTATAAACCTCTTTT[T/G]
TCTCATCGTCTTGGGGGGGCTAACCCCCCTCAAGATCACACAGCTCCGCTCACCAAGCCCTCGAATCTCACCCGCTGCCTCCGGCCGAACTCACAAAGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 18.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 18.30% | 81.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724166441 | A -> C | LOC_Os07g40300.1 | downstream_gene_variant ; 1400.0bp to feature; MODIFIER | silent_mutation | Average:48.563; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0724166441 | A -> C | LOC_Os07g40300-LOC_Os07g40310 | intergenic_region ; MODIFIER | silent_mutation | Average:48.563; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724166441 | NA | 1.11E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | NA | 8.16E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | NA | 3.08E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | NA | 1.41E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | 8.51E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | 2.22E-07 | NA | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724166441 | NA | 8.58E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |