| Variant ID: vg0723605774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23605774 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTATAATCCTTGTCTTCTATTTGCTTGATGTCATATTACGTAAATCCTTGTTCCAACGTATCCCAATACCCAAATCATCCGGTCTACGAGTACCACTCAT[T/C]
GACAGTGGCACGCCAGGTAGGGGAACTTGGTGCTCAAGGTTCTACAAATATGACTTCAAGCCATCCCGACAACAGTACCAACACCGGCGTCAATCAAGGA
TCCTTGATTGACGCCGGTGTTGGTACTGTTGTCGGGATGGCTTGAAGTCATATTTGTAGAACCTTGAGCACCAAGTTCCCCTACCTGGCGTGCCACTGTC[A/G]
ATGAGTGGTACTCGTAGACCGGATGATTTGGGTATTGGGATACGTTGGAACAAGGATTTACGTAATATGACATCAAGCAAATAGAAGACAAGGATTATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 11.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 68.60% | 31.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 41.10% | 58.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723605774 | T -> C | LOC_Os07g39400.1 | upstream_gene_variant ; 1408.0bp to feature; MODIFIER | silent_mutation | Average:70.24; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0723605774 | T -> C | LOC_Os07g39410.1 | upstream_gene_variant ; 167.0bp to feature; MODIFIER | silent_mutation | Average:70.24; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0723605774 | T -> C | LOC_Os07g39400-LOC_Os07g39410 | intergenic_region ; MODIFIER | silent_mutation | Average:70.24; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723605774 | 1.99E-06 | 1.99E-06 | mr1260 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 1.02E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 2.59E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 3.54E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 8.26E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | 7.12E-06 | 7.12E-06 | mr1899 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 4.99E-06 | mr1170_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 7.06E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 8.73E-08 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723605774 | NA | 8.43E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |