\
| Variant ID: vg0723516704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23516704 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, G: 0.31, others allele: 0.00, population size: 204. )
CCGTTATGGGTTCCACCTTCATCTGACACAAGTTGACAAATGCCTTTGGGTCTACGTTTTCGACAAAAACCGATCGAACACCATGAAATTTTGAAGTTTC[G/T]
ATTGGGACAAAAGTAGACTCTGAGTAAAAATTTAGATGGTTTTCAAGAATTTAAATTGAAACAGTAAAATCAATCAAAATTTGGTTGAAAGTTATACCGC
GCGGTATAACTTTCAACCAAATTTTGATTGATTTTACTGTTTCAATTTAAATTCTTGAAAACCATCTAAATTTTTACTCAGAGTCTACTTTTGTCCCAAT[C/A]
GAAACTTCAAAATTTCATGGTGTTCGATCGGTTTTTGTCGAAAACGTAGACCCAAAGGCATTTGTCAACTTGTGTCAGATGAAGGTGGAACCCATAACGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 29.80% | 0.30% | 0.06% | NA |
| All Indica | 2759 | 95.10% | 4.50% | 0.25% | 0.07% | NA |
| All Japonica | 1512 | 21.40% | 78.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.50% | 8.80% | 0.22% | 0.43% | NA |
| Indica III | 913 | 98.10% | 1.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 9.50% | 90.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 29.40% | 70.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.30% | 57.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 38.50% | 60.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 40.00% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723516704 | G -> DEL | N | N | silent_mutation | Average:61.464; most accessible tissue: Callus, score: 76.048 | N | N | N | N |
| vg0723516704 | G -> T | LOC_Os07g39280.1 | upstream_gene_variant ; 1072.0bp to feature; MODIFIER | silent_mutation | Average:61.464; most accessible tissue: Callus, score: 76.048 | N | N | N | N |
| vg0723516704 | G -> T | LOC_Os07g39280-LOC_Os07g39290 | intergenic_region ; MODIFIER | silent_mutation | Average:61.464; most accessible tissue: Callus, score: 76.048 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723516704 | NA | 6.85E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 6.56E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | 5.25E-10 | 2.83E-54 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | 2.24E-07 | 3.82E-06 | mr1563 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 3.16E-44 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 6.38E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 2.04E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | 1.39E-14 | 2.23E-94 | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | 1.69E-16 | 5.86E-16 | mr1563_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 3.49E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723516704 | NA | 3.13E-09 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |