\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723516704:

Variant ID: vg0723516704 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23516704
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, G: 0.31, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTATGGGTTCCACCTTCATCTGACACAAGTTGACAAATGCCTTTGGGTCTACGTTTTCGACAAAAACCGATCGAACACCATGAAATTTTGAAGTTTC[G/T]
ATTGGGACAAAAGTAGACTCTGAGTAAAAATTTAGATGGTTTTCAAGAATTTAAATTGAAACAGTAAAATCAATCAAAATTTGGTTGAAAGTTATACCGC

Reverse complement sequence

GCGGTATAACTTTCAACCAAATTTTGATTGATTTTACTGTTTCAATTTAAATTCTTGAAAACCATCTAAATTTTTACTCAGAGTCTACTTTTGTCCCAAT[C/A]
GAAACTTCAAAATTTCATGGTGTTCGATCGGTTTTTGTCGAAAACGTAGACCCAAAGGCATTTGTCAACTTGTGTCAGATGAAGGTGGAACCCATAACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 29.80% 0.30% 0.06% NA
All Indica  2759 95.10% 4.50% 0.25% 0.07% NA
All Japonica  1512 21.40% 78.50% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.30% 3.50% 0.17% 0.00% NA
Indica II  465 90.50% 8.80% 0.22% 0.43% NA
Indica III  913 98.10% 1.50% 0.33% 0.00% NA
Indica Intermediate  786 93.50% 6.20% 0.25% 0.00% NA
Temperate Japonica  767 9.50% 90.40% 0.13% 0.00% NA
Tropical Japonica  504 29.40% 70.40% 0.20% 0.00% NA
Japonica Intermediate  241 42.30% 57.70% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 54.40% 40.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723516704 G -> DEL N N silent_mutation Average:61.464; most accessible tissue: Callus, score: 76.048 N N N N
vg0723516704 G -> T LOC_Os07g39280.1 upstream_gene_variant ; 1072.0bp to feature; MODIFIER silent_mutation Average:61.464; most accessible tissue: Callus, score: 76.048 N N N N
vg0723516704 G -> T LOC_Os07g39280-LOC_Os07g39290 intergenic_region ; MODIFIER silent_mutation Average:61.464; most accessible tissue: Callus, score: 76.048 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723516704 NA 6.85E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 6.56E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 5.25E-10 2.83E-54 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 2.24E-07 3.82E-06 mr1563 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 3.16E-44 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 6.38E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 2.04E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 1.39E-14 2.23E-94 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 1.69E-16 5.86E-16 mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 3.49E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723516704 NA 3.13E-09 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251