\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723337151:

Variant ID: vg0723337151 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23337151
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCCGACGTACCCAGGTTAGGGTGGGCTTGATGGAGTTGGGTCGGCCGGGGTGTTCGGTTGATCGGCTTT[C/T]
GGATTCACCGTGGCACGAGAGGGGGGCTGCCCGTTGCCTACTGGGAACGGGGGCGAACCCTGAGGTGTGGTACGATCGGTTAGAGGGGGTTATGCGAAGG

Reverse complement sequence

CCTTCGCATAACCCCCTCTAACCGATCGTACCACACCTCAGGGTTCGCCCCCGTTCCCAGTAGGCAACGGGCAGCCCCCCTCTCGTGCCACGGTGAATCC[G/A]
AAAGCCGATCAACCGAACACCCCGGCCGACCCAACTCCATCAAGCCCACCCTAACCTGGGTACGTCGGCTAGAGGAAAGCTACACTACAAGCCCAGCCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 10.10% 13.08% 7.70% NA
All Indica  2759 67.20% 9.60% 19.39% 3.81% NA
All Japonica  1512 80.30% 0.30% 2.38% 17.00% NA
Aus  269 11.90% 73.20% 14.87% 0.00% NA
Indica I  595 55.00% 5.50% 34.62% 4.87% NA
Indica II  465 62.60% 12.70% 20.22% 4.52% NA
Indica III  913 76.80% 9.00% 12.92% 1.31% NA
Indica Intermediate  786 67.90% 11.70% 14.89% 5.47% NA
Temperate Japonica  767 88.50% 0.00% 0.13% 11.34% NA
Tropical Japonica  504 72.80% 1.00% 5.36% 20.83% NA
Japonica Intermediate  241 69.70% 0.00% 3.32% 26.97% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 83.30% 6.70% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723337151 C -> DEL N N silent_mutation Average:6.183; most accessible tissue: Callus, score: 15.799 N N N N
vg0723337151 C -> T LOC_Os07g38910-LOC_Os07g38930 intergenic_region ; MODIFIER silent_mutation Average:6.183; most accessible tissue: Callus, score: 15.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723337151 6.67E-06 6.42E-14 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.09E-13 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 1.63E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 8.30E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 8.04E-06 9.13E-41 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 2.57E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 4.31E-13 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 2.13E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.76E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 2.99E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 6.09E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.01E-15 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 5.04E-13 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.98E-11 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 4.24E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 5.93E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.88E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 5.35E-19 mr1818_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 1.74E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 9.81E-08 2.30E-53 mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 6.13E-06 2.10E-27 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 4.14E-19 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 2.66E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 7.98E-20 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 1.05E-13 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.74E-23 mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151 NA 3.43E-13 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251