Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723337151:

Variant ID: vg0723337151 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23337151
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCCGACGTACCCAGGTTAGGGTGGGCTTGATGGAGTTGGGTCGGCCGGGGTGTTCGGTTGATCGGCTTT[C/T]
GGATTCACCGTGGCACGAGAGGGGGGCTGCCCGTTGCCTACTGGGAACGGGGGCGAACCCTGAGGTGTGGTACGATCGGTTAGAGGGGGTTATGCGAAGG

Reverse complement sequence

CCTTCGCATAACCCCCTCTAACCGATCGTACCACACCTCAGGGTTCGCCCCCGTTCCCAGTAGGCAACGGGCAGCCCCCCTCTCGTGCCACGGTGAATCC[G/A]
AAAGCCGATCAACCGAACACCCCGGCCGACCCAACTCCATCAAGCCCACCCTAACCTGGGTACGTCGGCTAGAGGAAAGCTACACTACAAGCCCAGCCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	10.10%	13.08%	7.70%	NA
All Indica	2759	67.20%	9.60%	19.39%	3.81%	NA
All Japonica	1512	80.30%	0.30%	2.38%	17.00%	NA
Aus	269	11.90%	73.20%	14.87%	0.00%	NA
Indica I	595	55.00%	5.50%	34.62%	4.87%	NA
Indica II	465	62.60%	12.70%	20.22%	4.52%	NA
Indica III	913	76.80%	9.00%	12.92%	1.31%	NA
Indica Intermediate	786	67.90%	11.70%	14.89%	5.47%	NA
Temperate Japonica	767	88.50%	0.00%	0.13%	11.34%	NA
Tropical Japonica	504	72.80%	1.00%	5.36%	20.83%	NA
Japonica Intermediate	241	69.70%	0.00%	3.32%	26.97%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	6.70%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723337151	C -> DEL	N	N	silent_mutation	Average:6.183; most accessible tissue: Callus, score: 15.799	N	N	N	N
vg0723337151	C -> T	LOC_Os07g38910-LOC_Os07g38930	intergenic_region ; MODIFIER	silent_mutation	Average:6.183; most accessible tissue: Callus, score: 15.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723337151	6.67E-06	6.42E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.09E-13	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	1.63E-07	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	8.30E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	8.04E-06	9.13E-41	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	2.57E-24	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	4.31E-13	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	2.13E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.76E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	2.99E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	6.09E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.01E-15	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	5.04E-13	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.98E-11	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	4.24E-08	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	5.93E-13	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.88E-08	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	5.35E-19	mr1818_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	1.74E-11	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	9.81E-08	2.30E-53	mr1855_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	6.13E-06	2.10E-27	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	4.14E-19	mr1897_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	2.66E-10	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	7.98E-20	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	1.05E-13	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.74E-23	mr1927_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723337151	NA	3.43E-13	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251