\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723332364:

Variant ID: vg0723332364 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23332364
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.06, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GACTTTGAGGATCCTAGTAGCAATTTAGCATCCCTGCTTTATCACCTTCCTGTCATATAGTATATATAGTGCTTACCCTTTACAGCCGGGGGTAGAGAGA[T/A]
TTATCAGTCTTCCCATGGATGGCAATGGCATGTTCGTCCAGAGAAAGTTGGCAGCTGCTCCAACTTTTTCTGCAAAGATTTGGTTCTTGTGGTCGGCCGA

Reverse complement sequence

TCGGCCGACCACAAGAACCAAATCTTTGCAGAAAAAGTTGGAGCAGCTGCCAACTTTCTCTGGACGAACATGCCATTGCCATCCATGGGAAGACTGATAA[A/T]
TCTCTCTACCCCCGGCTGTAAAGGGTAAGCACTATATATACTATATGACAGGAAGGTGATAAAGCAGGGATGCTAAATTGCTACTAGGATCCTCAAAGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 17.30% 0.23% 58.10% NA
All Indica  2759 4.70% 9.40% 0.25% 85.68% NA
All Japonica  1512 61.40% 32.90% 0.07% 5.56% NA
Aus  269 1.10% 0.40% 0.74% 97.77% NA
Indica I  595 4.90% 1.30% 0.17% 93.61% NA
Indica II  465 4.10% 13.10% 0.43% 82.37% NA
Indica III  913 2.10% 12.40% 0.11% 85.43% NA
Indica Intermediate  786 8.00% 9.70% 0.38% 81.93% NA
Temperate Japonica  767 86.30% 13.40% 0.00% 0.26% NA
Tropical Japonica  504 32.30% 54.20% 0.20% 13.29% NA
Japonica Intermediate  241 43.20% 50.60% 0.00% 6.22% NA
VI/Aromatic  96 62.50% 36.50% 0.00% 1.04% NA
Intermediate  90 34.40% 26.70% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723332364 T -> DEL N N silent_mutation Average:33.415; most accessible tissue: Callus, score: 95.727 N N N N
vg0723332364 T -> A LOC_Os07g38910.1 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 95.727 N N N N
vg0723332364 T -> A LOC_Os07g38900.1 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 95.727 N N N N
vg0723332364 T -> A LOC_Os07g38910-LOC_Os07g38930 intergenic_region ; MODIFIER silent_mutation Average:33.415; most accessible tissue: Callus, score: 95.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723332364 NA 1.07E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 4.72E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 1.02E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 3.10E-30 4.20E-84 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 9.41E-14 3.16E-23 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 2.73E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 3.76E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 1.13E-54 7.04E-137 mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 2.65E-25 4.41E-36 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 1.44E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364 NA 2.86E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251