Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0723332364:

Variant ID: vg0723332364 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23332364
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.06, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GACTTTGAGGATCCTAGTAGCAATTTAGCATCCCTGCTTTATCACCTTCCTGTCATATAGTATATATAGTGCTTACCCTTTACAGCCGGGGGTAGAGAGA[T/A]
TTATCAGTCTTCCCATGGATGGCAATGGCATGTTCGTCCAGAGAAAGTTGGCAGCTGCTCCAACTTTTTCTGCAAAGATTTGGTTCTTGTGGTCGGCCGA

Reverse complement sequence

TCGGCCGACCACAAGAACCAAATCTTTGCAGAAAAAGTTGGAGCAGCTGCCAACTTTCTCTGGACGAACATGCCATTGCCATCCATGGGAAGACTGATAA[A/T]
TCTCTCTACCCCCGGCTGTAAAGGGTAAGCACTATATATACTATATGACAGGAAGGTGATAAAGCAGGGATGCTAAATTGCTACTAGGATCCTCAAAGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.40%	17.30%	0.23%	58.10%	NA
All Indica	2759	4.70%	9.40%	0.25%	85.68%	NA
All Japonica	1512	61.40%	32.90%	0.07%	5.56%	NA
Aus	269	1.10%	0.40%	0.74%	97.77%	NA
Indica I	595	4.90%	1.30%	0.17%	93.61%	NA
Indica II	465	4.10%	13.10%	0.43%	82.37%	NA
Indica III	913	2.10%	12.40%	0.11%	85.43%	NA
Indica Intermediate	786	8.00%	9.70%	0.38%	81.93%	NA
Temperate Japonica	767	86.30%	13.40%	0.00%	0.26%	NA
Tropical Japonica	504	32.30%	54.20%	0.20%	13.29%	NA
Japonica Intermediate	241	43.20%	50.60%	0.00%	6.22%	NA
VI/Aromatic	96	62.50%	36.50%	0.00%	1.04%	NA
Intermediate	90	34.40%	26.70%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723332364	T -> DEL	N	N	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 95.727	N	N	N	N
vg0723332364	T -> A	LOC_Os07g38910.1	upstream_gene_variant ; 1518.0bp to feature; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 95.727	N	N	N	N
vg0723332364	T -> A	LOC_Os07g38900.1	downstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 95.727	N	N	N	N
vg0723332364	T -> A	LOC_Os07g38910-LOC_Os07g38930	intergenic_region ; MODIFIER	silent_mutation	Average:33.415; most accessible tissue: Callus, score: 95.727	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723332364	NA	1.07E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	4.72E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	1.02E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	3.10E-30	4.20E-84	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	9.41E-14	3.16E-23	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	2.73E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	3.76E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	1.13E-54	7.04E-137	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	2.65E-25	4.41E-36	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	1.44E-07	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723332364	NA	2.86E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251