| Variant ID: vg0723286803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23286803 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.21, others allele: 0.00, population size: 80. )
AATTCGAAATAAAAATAAAATAAAATCTAAAATTAGAAAAAAAAAGAGAGAGTCCAAGTAGAAATAAAATTTAAAAATAGCTGAAATTCGGAATTAAAAA[T/C,A]
AAGGAATATTGAAAAAAGTTTTCATATAAGAACCCAATATGAGATTAATCAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAGAAAAGAAAATGA
TCATTTTCTTTTCTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTGATTAATCTCATATTGGGTTCTTATATGAAAACTTTTTTCAATATTCCTT[A/G,T]
TTTTTAATTCCGAATTTCAGCTATTTTTAAATTTTATTTCTACTTGGACTCTCTCTTTTTTTTTCTAATTTTAGATTTTATTTTATTTTTATTTCGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 39.80% | 1.06% | 1.44% | NA |
| All Indica | 2759 | 84.80% | 11.20% | 1.67% | 2.39% | NA |
| All Japonica | 1512 | 6.00% | 94.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.10% | 0.37% | 0.74% | NA |
| Indica I | 595 | 92.40% | 2.20% | 2.18% | 3.19% | NA |
| Indica II | 465 | 77.00% | 16.30% | 2.15% | 4.52% | NA |
| Indica III | 913 | 85.10% | 13.90% | 0.44% | 0.55% | NA |
| Indica Intermediate | 786 | 83.20% | 11.70% | 2.42% | 2.67% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 58.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723286803 | T -> DEL | N | N | silent_mutation | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> A | LOC_Os07g38810.1 | upstream_gene_variant ; 1830.0bp to feature; MODIFIER | N | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> A | LOC_Os07g38820.1 | downstream_gene_variant ; 2475.0bp to feature; MODIFIER | N | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> A | LOC_Os07g38810-LOC_Os07g38820 | intergenic_region ; MODIFIER | N | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> C | LOC_Os07g38810.1 | upstream_gene_variant ; 1830.0bp to feature; MODIFIER | silent_mutation | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> C | LOC_Os07g38820.1 | downstream_gene_variant ; 2475.0bp to feature; MODIFIER | silent_mutation | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| vg0723286803 | T -> C | LOC_Os07g38810-LOC_Os07g38820 | intergenic_region ; MODIFIER | silent_mutation | Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723286803 | NA | 9.75E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 2.03E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 4.95E-39 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 1.42E-36 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 2.47E-23 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 1.42E-32 | mr1149_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 2.18E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 2.24E-29 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 5.07E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723286803 | NA | 7.55E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |