\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723286803:

Variant ID: vg0723286803 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23286803
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.21, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCGAAATAAAAATAAAATAAAATCTAAAATTAGAAAAAAAAAGAGAGAGTCCAAGTAGAAATAAAATTTAAAAATAGCTGAAATTCGGAATTAAAAA[T/C,A]
AAGGAATATTGAAAAAAGTTTTCATATAAGAACCCAATATGAGATTAATCAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAGAAAAGAAAATGA

Reverse complement sequence

TCATTTTCTTTTCTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTGATTAATCTCATATTGGGTTCTTATATGAAAACTTTTTTCAATATTCCTT[A/G,T]
TTTTTAATTCCGAATTTCAGCTATTTTTAAATTTTATTTCTACTTGGACTCTCTCTTTTTTTTTCTAATTTTAGATTTTATTTTATTTTTATTTCGAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 39.80% 1.06% 1.44% NA
All Indica  2759 84.80% 11.20% 1.67% 2.39% NA
All Japonica  1512 6.00% 94.00% 0.07% 0.00% NA
Aus  269 97.80% 1.10% 0.37% 0.74% NA
Indica I  595 92.40% 2.20% 2.18% 3.19% NA
Indica II  465 77.00% 16.30% 2.15% 4.52% NA
Indica III  913 85.10% 13.90% 0.44% 0.55% NA
Indica Intermediate  786 83.20% 11.70% 2.42% 2.67% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 14.50% 85.50% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723286803 T -> DEL N N silent_mutation Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> A LOC_Os07g38810.1 upstream_gene_variant ; 1830.0bp to feature; MODIFIER N Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> A LOC_Os07g38820.1 downstream_gene_variant ; 2475.0bp to feature; MODIFIER N Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> A LOC_Os07g38810-LOC_Os07g38820 intergenic_region ; MODIFIER N Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> C LOC_Os07g38810.1 upstream_gene_variant ; 1830.0bp to feature; MODIFIER silent_mutation Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> C LOC_Os07g38820.1 downstream_gene_variant ; 2475.0bp to feature; MODIFIER silent_mutation Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N
vg0723286803 T -> C LOC_Os07g38810-LOC_Os07g38820 intergenic_region ; MODIFIER silent_mutation Average:12.03; most accessible tissue: Zhenshan97 flower, score: 17.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723286803 NA 9.75E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 2.03E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 4.95E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 1.42E-36 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 2.47E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 1.42E-32 mr1149_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 2.18E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 2.24E-29 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 5.07E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723286803 NA 7.55E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251