\
| Variant ID: vg0723191618 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 23191618 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 105. )
TTACTACTTACTACTTCCTCCGTCCCATAATATAAGGGATTTTGAGTTTTTGCTTATACTGTTTGATCACTCGTATTATTAAAAAAATTTGTGCAAATAT[A/T]
AAAAACGAAAAGTTGTGATTAAAGTACTTTGGATAATAAAATAAGTCACAAAAAATAAATAATAATTTCAAAAACTTTTGAATAAGACGAGTGGCCAAAC
GTTTGGCCACTCGTCTTATTCAAAAGTTTTTGAAATTATTATTTATTTTTTGTGACTTATTTTATTATCCAAAGTACTTTAATCACAACTTTTCGTTTTT[T/A]
ATATTTGCACAAATTTTTTTAATAATACGAGTGATCAAACAGTATAAGCAAAAACTCAAAATCCCTTATATTATGGGACGGAGGAAGTAGTAAGTAGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 48.30% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 74.00% | 25.50% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 5.90% | 93.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 4.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 65.80% | 33.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 67.10% | 32.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 71.20% | 28.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 13.70% | 86.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 99.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 67.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0723191618 | A -> T | LOC_Os07g38600.1 | upstream_gene_variant ; 4678.0bp to feature; MODIFIER | silent_mutation | Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0723191618 | A -> T | LOC_Os07g38620.1 | downstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0723191618 | A -> T | LOC_Os07g38610.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0723191618 | NA | 5.25E-07 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 6.55E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 2.49E-09 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 3.75E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 4.11E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | 9.58E-07 | NA | mr1377 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | 5.25E-06 | 5.25E-06 | mr1377 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 7.25E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0723191618 | NA | 6.69E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |