\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723191618:

Variant ID: vg0723191618 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23191618
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTACTACTTACTACTTCCTCCGTCCCATAATATAAGGGATTTTGAGTTTTTGCTTATACTGTTTGATCACTCGTATTATTAAAAAAATTTGTGCAAATAT[A/T]
AAAAACGAAAAGTTGTGATTAAAGTACTTTGGATAATAAAATAAGTCACAAAAAATAAATAATAATTTCAAAAACTTTTGAATAAGACGAGTGGCCAAAC

Reverse complement sequence

GTTTGGCCACTCGTCTTATTCAAAAGTTTTTGAAATTATTATTTATTTTTTGTGACTTATTTTATTATCCAAAGTACTTTAATCACAACTTTTCGTTTTT[T/A]
ATATTTGCACAAATTTTTTTAATAATACGAGTGATCAAACAGTATAAGCAAAAACTCAAAATCCCTTATATTATGGGACGGAGGAAGTAGTAAGTAGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.30% 0.38% 0.00% NA
All Indica  2759 74.00% 25.50% 0.43% 0.00% NA
All Japonica  1512 5.90% 93.90% 0.20% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.80% 4.90% 0.34% 0.00% NA
Indica II  465 65.80% 33.80% 0.43% 0.00% NA
Indica III  913 67.10% 32.40% 0.44% 0.00% NA
Indica Intermediate  786 71.20% 28.20% 0.51% 0.00% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 13.70% 86.10% 0.20% 0.00% NA
Japonica Intermediate  241 6.20% 93.40% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 99.00% 1.04% 0.00% NA
Intermediate  90 30.00% 67.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723191618 A -> T LOC_Os07g38600.1 upstream_gene_variant ; 4678.0bp to feature; MODIFIER silent_mutation Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg0723191618 A -> T LOC_Os07g38620.1 downstream_gene_variant ; 2585.0bp to feature; MODIFIER silent_mutation Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg0723191618 A -> T LOC_Os07g38610.1 intron_variant ; MODIFIER silent_mutation Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723191618 NA 5.25E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 6.55E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 2.49E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 3.75E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 4.11E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 9.58E-07 NA mr1377 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 5.25E-06 5.25E-06 mr1377 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 7.25E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618 NA 6.69E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251