Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0723120973:

Variant ID: vg0723120973 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23120973
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGCAGCAAGAGTCGCCCGTGAGAGCGAAACCATGGACAGAGTTGTCTATCGGTTGGAGCTTGGAAGTTGCTAGCTTCAGGGCCCATTTGAATCGCAGGG[T/C]
TGAAAAAATGAAGGAATAGGAAAAACACAGAATTCTAATAGGAATTGAAGTGTAAAACAGAGGATTGCAAAACACAGGAAAAACACGGAAATAATCGTTT

Reverse complement sequence

AAACGATTATTTCCGTGTTTTTCCTGTGTTTTGCAATCCTCTGTTTTACACTTCAATTCCTATTAGAATTCTGTGTTTTTCCTATTCCTTCATTTTTTCA[A/G]
CCCTGCGATTCAAATGGGCCCTGAAGCTAGCAACTTCCAAGCTCCAACCGATAGACAACTCTGTCCATGGTTTCGCTCTCACGGGCGACTCTTGCTGCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	5.40%	10.69%	40.20%	NA
All Indica	2759	23.00%	0.20%	16.64%	60.20%	NA
All Japonica	1512	86.80%	12.80%	0.13%	0.33%	NA
Aus	269	6.70%	0.00%	14.87%	78.44%	NA
Indica I	595	12.80%	0.00%	28.40%	58.82%	NA
Indica II	465	28.20%	0.00%	11.40%	60.43%	NA
Indica III	913	25.50%	0.30%	11.28%	62.87%	NA
Indica Intermediate	786	24.70%	0.30%	17.05%	58.02%	NA
Temperate Japonica	767	86.70%	12.80%	0.26%	0.26%	NA
Tropical Japonica	504	87.50%	12.10%	0.00%	0.40%	NA
Japonica Intermediate	241	85.50%	14.10%	0.00%	0.41%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	5.60%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723120973	T -> DEL	N	N	silent_mutation	Average:79.898; most accessible tissue: Zhenshan97 flower, score: 90.915	N	N	N	N
vg0723120973	T -> C	LOC_Os07g38490.1	downstream_gene_variant ; 1153.0bp to feature; MODIFIER	silent_mutation	Average:79.898; most accessible tissue: Zhenshan97 flower, score: 90.915	N	N	N	N
vg0723120973	T -> C	LOC_Os07g38490-LOC_Os07g38500	intergenic_region ; MODIFIER	silent_mutation	Average:79.898; most accessible tissue: Zhenshan97 flower, score: 90.915	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0723120973	T	C	-0.01	0.0	0.0	-0.01	0.0	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723120973	NA	4.07E-21	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723120973	NA	2.26E-10	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0723120973	NA	6.76E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723120973	NA	3.72E-14	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723120973	NA	6.13E-13	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723120973	1.95E-10	1.06E-25	mr1842_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723120973	6.65E-06	1.10E-07	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723120973	1.87E-06	NA	mr1933_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251