\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723095855:

Variant ID: vg0723095855 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 23095855
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGTTATATGCAAGTTACAATATAATTACATTACGATTGTACTATAATTACATCTGTCAAATTTTTAGGACAAAATTTATCGATAAATATATAGGTGGT[A/C]
CAGTACCGTTACGGCCCAACTAATTACATGGGCTTCACTAACTACAGTAGATTATTATTTAATTCAATTTAGTCCAGTATAAGTTGTCACTGTCGCTGCT

Reverse complement sequence

AGCAGCGACAGTGACAACTTATACTGGACTAAATTGAATTAAATAATAATCTACTGTAGTTAGTGAAGCCCATGTAATTAGTTGGGCCGTAACGGTACTG[T/G]
ACCACCTATATATTTATCGATAAATTTTGTCCTAAAAATTTGACAGATGTAATTATAGTACAATCGTAATGTAATTATATTGTAACTTGCATATAACTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.00% 0.19% 0.00% NA
All Indica  2759 75.90% 24.00% 0.11% 0.00% NA
All Japonica  1512 24.10% 75.60% 0.33% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 64.10% 35.90% 0.00% 0.00% NA
Indica III  913 68.60% 31.30% 0.11% 0.00% NA
Indica Intermediate  786 74.60% 25.20% 0.25% 0.00% NA
Temperate Japonica  767 42.10% 57.60% 0.26% 0.00% NA
Tropical Japonica  504 4.60% 95.20% 0.20% 0.00% NA
Japonica Intermediate  241 7.50% 91.70% 0.83% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0723095855 A -> C LOC_Os07g38420.1 upstream_gene_variant ; 4934.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Zhenshan97 young leaf, score: 98.321 N N N N
vg0723095855 A -> C LOC_Os07g38440.1 upstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Zhenshan97 young leaf, score: 98.321 N N N N
vg0723095855 A -> C LOC_Os07g38430.1 downstream_gene_variant ; 1395.0bp to feature; MODIFIER silent_mutation Average:94.473; most accessible tissue: Zhenshan97 young leaf, score: 98.321 N N N N
vg0723095855 A -> C LOC_Os07g38430-LOC_Os07g38440 intergenic_region ; MODIFIER silent_mutation Average:94.473; most accessible tissue: Zhenshan97 young leaf, score: 98.321 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0723095855 A C 0.05 0.07 0.05 0.03 0.04 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0723095855 NA 8.06E-06 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 2.31E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 7.10E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.15E-06 mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.92E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 4.15E-11 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 5.84E-06 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 5.68E-06 mr1263 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 1.61E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 2.07E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 3.66E-07 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.09E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 3.66E-07 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 5.68E-06 mr1451 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 8.23E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 4.13E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 1.69E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 5.15E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 7.54E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 3.44E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.23E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.39E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 4.26E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 9.19E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 6.10E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 9.65E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723095855 NA 1.23E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251