\
| Variant ID: vg0722959446 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22959446 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.05, others allele: 0.00, population size: 227. )
ATATTTTGATTTCTGATCAACAATAAGTATTGTCTACACAATACTTACTCCCTTCAGTAAAGAAAAAGGTAAATTGTGATTCTCGGAGTCAAGACAATGC[C/G]
CACTTTGACCACTAGATTATAACATCATATGCCCTGAGAAAAGTACATTGACCACTGATATCATGCAAGTACTTTTCATACAAATTGACCAATCAAGGCA
TGCCTTGATTGGTCAATTTGTATGAAAAGTACTTGCATGATATCAGTGGTCAATGTACTTTTCTCAGGGCATATGATGTTATAATCTAGTGGTCAAAGTG[G/C]
GCATTGTCTTGACTCCGAGAATCACAATTTACCTTTTTCTTTACTGAAGGGAGTAAGTATTGTGTAGACAATACTTATTGTTGATCAGAAATCAAAATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 46.20% | 0.23% | 0.25% | NA |
| All Indica | 2759 | 30.60% | 68.60% | 0.36% | 0.43% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.50% | 95.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 47.70% | 50.30% | 1.29% | 0.65% | NA |
| Indica III | 913 | 39.10% | 60.40% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 30.20% | 69.20% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722959446 | C -> DEL | N | N | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 71.597 | N | N | N | N |
| vg0722959446 | C -> G | LOC_Os07g38260.1 | upstream_gene_variant ; 4627.0bp to feature; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 71.597 | N | N | N | N |
| vg0722959446 | C -> G | LOC_Os07g38270.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.649; most accessible tissue: Callus, score: 71.597 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722959446 | NA | 1.29E-17 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 8.55E-16 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.35E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 9.43E-13 | mr1222 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 6.48E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.35E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 3.08E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 8.32E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.82E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.82E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 3.57E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 3.12E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.67E-19 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.09E-33 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 5.10E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 2.87E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 7.85E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722959446 | NA | 1.19E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |