Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0722755496:

Variant ID: vg0722755496 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22755496
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGGGCAACCCCAAAGGTATATAAAGTTCATATCTCATGGGATAATGATGAACAGTGCAACTAGCTACTTTCTGCATCCGCTATATATGGTACAAAC[G/A]
CATGAAGCTAACACCATATCTATGTGTTAGCTGCAGCACTACTTTCTGAATGCGATATATATGATGCAAACGCATGTGAAGGCAAAGCCATATGATCTAC

Reverse complement sequence

GTAGATCATATGGCTTTGCCTTCACATGCGTTTGCATCATATATATCGCATTCAGAAAGTAGTGCTGCAGCTAACACATAGATATGGTGTTAGCTTCATG[C/T]
GTTTGTACCATATATAGCGGATGCAGAAAGTAGCTAGTTGCACTGTTCATCATTATCCCATGAGATATGAACTTTATATACCTTTGGGGTTGCCCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 15.40% 1.59% 0.00% NA
All Indica  2759 97.00% 2.40% 0.62% 0.00% NA
All Japonica  1512 53.10% 43.20% 3.70% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.00% 0.67% 0.00% NA
Indica II  465 95.50% 3.70% 0.86% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 94.30% 4.80% 0.89% 0.00% NA
Temperate Japonica  767 83.60% 12.00% 4.43% 0.00% NA
Tropical Japonica  504 18.30% 80.00% 1.79% 0.00% NA
Japonica Intermediate  241 29.00% 65.60% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722755496 G -> A LOC_Os07g37920.1 3_prime_UTR_variant ; 380.0bp to feature; MODIFIER silent_mutation Average:77.11; most accessible tissue: Zhenshan97 flower, score: 97.949 N N N N
vg0722755496 G -> A LOC_Os07g37910.1 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:77.11; most accessible tissue: Zhenshan97 flower, score: 97.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722755496 G A -0.03 -0.03 -0.02 -0.01 -0.04 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722755496 NA 2.41E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722755496 NA 5.75E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 2.69E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 1.21E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 5.53E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 4.95E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 3.72E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 2.05E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 2.96E-06 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 1.41E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 1.43E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 6.68E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 1.36E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 5.69E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 1.71E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 9.08E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 2.81E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722755496 NA 2.44E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251