\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722474111:

Variant ID: vg0722474111 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22474111
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.48, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTTCATTTTTTATATTTGCACAAATATTTTGAATAAGACGAGTGGTCAAACAGTGCAAGAAAAAAACTTAAAATCTCTTATATTATGAGACGGAGG[G/A]
AGTAATACTTGATTTACCTCTCTACTTTAATTTAATTTAGAATACTAAAATCTTTAGCCAATTACAAATACTCCCTCCGTCCCCTAATACATTGTTTGAC

Reverse complement sequence

GTCAAACAATGTATTAGGGGACGGAGGGAGTATTTGTAATTGGCTAAAGATTTTAGTATTCTAAATTAAATTAAAGTAGAGAGGTAAATCAAGTATTACT[C/T]
CCTCCGTCTCATAATATAAGAGATTTTAAGTTTTTTTCTTGCACTGTTTGACCACTCGTCTTATTCAAAATATTTGTGCAAATATAAAAAATGAAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.00% 0.32% 0.00% NA
All Indica  2759 74.10% 25.60% 0.33% 0.00% NA
All Japonica  1512 36.80% 62.90% 0.26% 0.00% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 63.20% 36.30% 0.43% 0.00% NA
Indica III  913 59.00% 40.60% 0.33% 0.00% NA
Indica Intermediate  786 78.90% 20.60% 0.51% 0.00% NA
Temperate Japonica  767 53.70% 45.90% 0.39% 0.00% NA
Tropical Japonica  504 23.80% 76.20% 0.00% 0.00% NA
Japonica Intermediate  241 10.40% 89.20% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722474111 G -> A LOC_Os07g37530.1 upstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0722474111 G -> A LOC_Os07g37530.2 upstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0722474111 G -> A LOC_Os07g37520-LOC_Os07g37530 intergenic_region ; MODIFIER silent_mutation Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722474111 NA 6.90E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 3.52E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 5.52E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 3.75E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 1.33E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 5.88E-18 mr1531 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 5.20E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 7.69E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 1.30E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 9.62E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 5.64E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 8.37E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 6.45E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 2.83E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 8.28E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 3.14E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111 NA 3.61E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251