Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722474111:

Variant ID: vg0722474111 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22474111
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.48, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTTTCATTTTTTATATTTGCACAAATATTTTGAATAAGACGAGTGGTCAAACAGTGCAAGAAAAAAACTTAAAATCTCTTATATTATGAGACGGAGG[G/A]
AGTAATACTTGATTTACCTCTCTACTTTAATTTAATTTAGAATACTAAAATCTTTAGCCAATTACAAATACTCCCTCCGTCCCCTAATACATTGTTTGAC

Reverse complement sequence

GTCAAACAATGTATTAGGGGACGGAGGGAGTATTTGTAATTGGCTAAAGATTTTAGTATTCTAAATTAAATTAAAGTAGAGAGGTAAATCAAGTATTACT[C/T]
CCTCCGTCTCATAATATAAGAGATTTTAAGTTTTTTTCTTGCACTGTTTGACCACTCGTCTTATTCAAAATATTTGTGCAAATATAAAAAATGAAAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	43.00%	0.32%	0.00%	NA
All Indica	2759	74.10%	25.60%	0.33%	0.00%	NA
All Japonica	1512	36.80%	62.90%	0.26%	0.00%	NA
Aus	269	16.40%	83.60%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	63.20%	36.30%	0.43%	0.00%	NA
Indica III	913	59.00%	40.60%	0.33%	0.00%	NA
Indica Intermediate	786	78.90%	20.60%	0.51%	0.00%	NA
Temperate Japonica	767	53.70%	45.90%	0.39%	0.00%	NA
Tropical Japonica	504	23.80%	76.20%	0.00%	0.00%	NA
Japonica Intermediate	241	10.40%	89.20%	0.41%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722474111	G -> A	LOC_Os07g37530.1	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0722474111	G -> A	LOC_Os07g37530.2	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0722474111	G -> A	LOC_Os07g37520-LOC_Os07g37530	intergenic_region ; MODIFIER	silent_mutation	Average:28.485; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722474111	NA	6.90E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	3.52E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	5.52E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	3.75E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	1.33E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	5.88E-18	mr1531	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	5.20E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	7.69E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	1.30E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	9.62E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	5.64E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	8.37E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	6.45E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	2.83E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	8.28E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	3.14E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722474111	NA	3.61E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251