\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722264977:

Variant ID: vg0722264977 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22264977
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGACAGTGAATAACATCCAAAAGTTCAGAAACTTTCTCATCTTTTCTTGGAAGCAATTAAAGTCCAGCCAGGTTGCTGTTGGAAAGAAGAGTTTTTTT[A/T]
AAAAAAAATAATTAAGGAGGCCAGATTGTTGTGTTTTTTGAAATGAGAGTTACAGAGCCAATAATAACTGTATGATTAGAACAGCACAAATCCTTGTGGG

Reverse complement sequence

CCCACAAGGATTTGTGCTGTTCTAATCATACAGTTATTATTGGCTCTGTAACTCTCATTTCAAAAAACACAACAATCTGGCCTCCTTAATTATTTTTTTT[T/A]
AAAAAAACTCTTCTTTCCAACAGCAACCTGGCTGGACTTTAATTGCTTCCAAGAAAAGATGAGAAAGTTTCTGAACTTTTGGATGTTATTCACTGTCTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 31.00% 1.88% 0.00% NA
All Indica  2759 79.30% 20.30% 0.47% 0.00% NA
All Japonica  1512 55.60% 39.70% 4.76% 0.00% NA
Aus  269 21.60% 78.40% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 84.90% 14.60% 0.43% 0.00% NA
Indica III  913 73.60% 26.00% 0.44% 0.00% NA
Indica Intermediate  786 71.80% 27.40% 0.89% 0.00% NA
Temperate Japonica  767 85.10% 8.00% 6.91% 0.00% NA
Tropical Japonica  504 18.10% 79.40% 2.58% 0.00% NA
Japonica Intermediate  241 39.80% 57.70% 2.49% 0.00% NA
VI/Aromatic  96 28.10% 70.80% 1.04% 0.00% NA
Intermediate  90 64.40% 32.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722264977 A -> T LOC_Os07g37180.1 downstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:76.5; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg0722264977 A -> T LOC_Os07g37180.2 downstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:76.5; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg0722264977 A -> T LOC_Os07g37156-LOC_Os07g37180 intergenic_region ; MODIFIER silent_mutation Average:76.5; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722264977 A T -0.01 0.0 0.0 -0.01 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722264977 NA 1.62E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 7.45E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 2.21E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 5.20E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 4.65E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 2.65E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 1.72E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 1.44E-13 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 5.26E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 5.59E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 2.26E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 5.42E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 1.20E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 4.30E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 4.57E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 1.90E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 3.55E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 4.80E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 8.34E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722264977 NA 2.73E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251