\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722044007:

Variant ID: vg0722044007 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22044007
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCATGCCTGGCTGGATTTTCATGATCACGAGTATGCTGGCTCTTTTGAGTACTTCATCCGTCCTAAAATATAATAATCTAGAACCGGATAAGATATTT[T/C]
CTAACACTATGAATTTAGACATTTTCTGCTGTGTTATTAGCTCAATGAAACTTTGTTTGAGGGTTTTGGTGTAACTATTGGCTTTCTGTTATGGAAATGC

Reverse complement sequence

GCATTTCCATAACAGAAAGCCAATAGTTACACCAAAACCCTCAAACAAAGTTTCATTGAGCTAATAACACAGCAGAAAATGTCTAAATTCATAGTGTTAG[A/G]
AAATATCTTATCCGGTTCTAGATTATTATATTTTAGGACGGATGAAGTACTCAAAAGAGCCAGCATACTCGTGATCATGAAAATCCAGCCAGGCATGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.30% 0.08% 0.00% NA
All Indica  2759 87.00% 12.90% 0.07% 0.00% NA
All Japonica  1512 23.50% 76.40% 0.07% 0.00% NA
Aus  269 59.90% 40.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.90% 0.00% 0.00% NA
Temperate Japonica  767 5.00% 95.00% 0.00% 0.00% NA
Tropical Japonica  504 46.00% 54.00% 0.00% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722044007 T -> C LOC_Os07g36780.1 upstream_gene_variant ; 4283.0bp to feature; MODIFIER silent_mutation Average:54.337; most accessible tissue: Callus, score: 77.891 N N N N
vg0722044007 T -> C LOC_Os07g36800.1 upstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:54.337; most accessible tissue: Callus, score: 77.891 N N N N
vg0722044007 T -> C LOC_Os07g36800.2 upstream_gene_variant ; 1987.0bp to feature; MODIFIER silent_mutation Average:54.337; most accessible tissue: Callus, score: 77.891 N N N N
vg0722044007 T -> C LOC_Os07g36790.1 downstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:54.337; most accessible tissue: Callus, score: 77.891 N N N N
vg0722044007 T -> C LOC_Os07g36790-LOC_Os07g36800 intergenic_region ; MODIFIER silent_mutation Average:54.337; most accessible tissue: Callus, score: 77.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722044007 NA 1.70E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722044007 NA 3.06E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 9.04E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 1.79E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 6.67E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 3.82E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 1.13E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 5.79E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 1.04E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 2.05E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 2.56E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 2.98E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 2.81E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 2.17E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 3.79E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 6.22E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 2.01E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 9.11E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.23E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.22E-07 NA mr1155_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 9.66E-06 1.98E-07 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 1.71E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.13E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 3.76E-06 1.05E-08 mr1224_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.03E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 5.72E-07 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 3.78E-06 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 2.92E-09 mr1246_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.22E-07 NA mr1264_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 5.21E-06 NA mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 2.80E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 6.76E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 1.29E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 1.36E-06 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 NA 7.51E-07 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722044007 2.36E-06 1.83E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251