Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722026351:

Variant ID: vg0722026351 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22026351
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, G: 0.39, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

CGACGAAAACAGACTCGGACTCGGACCCTGCCGGTCTGACCGCCTACATACCTGCGGTCAGACCGGCCCTACTAGCCGGTCAGACCGCCCACACACCTGT[A/G]
GTCTGACCGCCCTGTGAAGGAAACCTGTCACTTTCCAAACTTTGGCAATCTTCCCCTATTTCGTCCATAGGTGCCAAATTTGGGTGTAAACACATGCCCC

Reverse complement sequence

GGGGCATGTGTTTACACCCAAATTTGGCACCTATGGACGAAATAGGGGAAGATTGCCAAAGTTTGGAAAGTGACAGGTTTCCTTCACAGGGCGGTCAGAC[T/C]
ACAGGTGTGTGGGCGGTCTGACCGGCTAGTAGGGCCGGTCTGACCGCAGGTATGTAGGCGGTCAGACCGGCAGGGTCCGAGTCCGAGTCTGTTTTCGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	34.90%	0.34%	5.27%	NA
All Indica	2759	87.30%	12.60%	0.04%	0.07%	NA
All Japonica	1512	6.20%	76.70%	0.93%	16.20%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	78.70%	21.10%	0.00%	0.22%	NA
Indica III	913	87.10%	12.70%	0.11%	0.11%	NA
Indica Intermediate	786	84.40%	15.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	95.30%	0.26%	4.04%	NA
Tropical Japonica	504	14.30%	54.40%	2.18%	29.17%	NA
Japonica Intermediate	241	7.90%	63.90%	0.41%	27.80%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	51.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722026351	A -> DEL	LOC_Os07g36760.1	N	frameshift_variant	Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0722026351	A -> G	LOC_Os07g36760.1	synonymous_variant ; p.Thr91Thr; LOW	synonymous_codon	Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0722026351	A -> G	LOC_Os07g36760.1	synonymous_variant ; p.Thr91Thr; LOW	nonsynonymous_codon ; T91N	Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	unknown	unknown	DELETERIOUS	0.02
vg0722026351	A -> G	LOC_Os07g36760.1	synonymous_variant ; p.Thr91Thr; LOW	nonsynonymous_codon ; T91I	Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	unknown	unknown	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722026351	4.31E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	1.23E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	7.77E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	9.13E-07	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	9.95E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	2.95E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	6.93E-07	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	3.31E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	1.39E-29	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	4.29E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	1.53E-06	NA	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	2.74E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	1.73E-25	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	5.94E-07	NA	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	3.09E-06	NA	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	1.16E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	1.52E-06	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	1.22E-06	NA	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	3.81E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	1.57E-06	NA	mr1437_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	1.24E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	1.83E-06	NA	mr1620_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	NA	7.11E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351	3.09E-06	2.34E-24	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251