\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722026351:

Variant ID: vg0722026351 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22026351
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, G: 0.39, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CGACGAAAACAGACTCGGACTCGGACCCTGCCGGTCTGACCGCCTACATACCTGCGGTCAGACCGGCCCTACTAGCCGGTCAGACCGCCCACACACCTGT[A/G]
GTCTGACCGCCCTGTGAAGGAAACCTGTCACTTTCCAAACTTTGGCAATCTTCCCCTATTTCGTCCATAGGTGCCAAATTTGGGTGTAAACACATGCCCC

Reverse complement sequence

GGGGCATGTGTTTACACCCAAATTTGGCACCTATGGACGAAATAGGGGAAGATTGCCAAAGTTTGGAAAGTGACAGGTTTCCTTCACAGGGCGGTCAGAC[T/C]
ACAGGTGTGTGGGCGGTCTGACCGGCTAGTAGGGCCGGTCTGACCGCAGGTATGTAGGCGGTCAGACCGGCAGGGTCCGAGTCCGAGTCTGTTTTCGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 34.90% 0.34% 5.27% NA
All Indica  2759 87.30% 12.60% 0.04% 0.07% NA
All Japonica  1512 6.20% 76.70% 0.93% 16.20% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 78.70% 21.10% 0.00% 0.22% NA
Indica III  913 87.10% 12.70% 0.11% 0.11% NA
Indica Intermediate  786 84.40% 15.60% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 95.30% 0.26% 4.04% NA
Tropical Japonica  504 14.30% 54.40% 2.18% 29.17% NA
Japonica Intermediate  241 7.90% 63.90% 0.41% 27.80% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722026351 A -> DEL LOC_Os07g36760.1 N frameshift_variant Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0722026351 A -> G LOC_Os07g36760.1 synonymous_variant ; p.Thr91Thr; LOW synonymous_codon Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0722026351 A -> G LOC_Os07g36760.1 synonymous_variant ; p.Thr91Thr; LOW nonsynonymous_codon ; T91N Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 unknown unknown DELETERIOUS 0.02
vg0722026351 A -> G LOC_Os07g36760.1 synonymous_variant ; p.Thr91Thr; LOW nonsynonymous_codon ; T91I Average:36.026; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 unknown unknown DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722026351 4.31E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 1.23E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 7.77E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 9.13E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 9.95E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 2.95E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 6.93E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 3.31E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 1.39E-29 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 4.29E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 1.53E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 2.74E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 1.73E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 5.94E-07 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 3.09E-06 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 1.16E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 1.52E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 1.22E-06 NA mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 3.81E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 1.57E-06 NA mr1437_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 1.24E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 1.83E-06 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 NA 7.11E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722026351 3.09E-06 2.34E-24 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251