\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721581014:

Variant ID: vg0721581014 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21581014
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGCCACGTGGGACGAAGACCGGGTCAACAGCGCCACGTCAGCAAAAACGCCCTCCAATACCGCTGAGGGAGTCAAATTGCACCGGTTTCAATAGTTCG[A/G]
GGAGTCGTTCTATCCGGTTTTCTGGTTGAGGGGTACGAATTAGAATCGGCGTACAATTAAGGGAGTTAATGTGGACTTTTTCCATAAGTATATTATGCCT

Reverse complement sequence

AGGCATAATATACTTATGGAAAAAGTCCACATTAACTCCCTTAATTGTACGCCGATTCTAATTCGTACCCCTCAACCAGAAAACCGGATAGAACGACTCC[T/C]
CGAACTATTGAAACCGGTGCAATTTGACTCCCTCAGCGGTATTGGAGGGCGTTTTTGCTGACGTGGCGCTGTTGACCCGGTCTTCGTCCCACGTGGCGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 30.60% 0.08% 0.00% NA
All Indica  2759 91.50% 8.40% 0.14% 0.00% NA
All Japonica  1512 29.30% 70.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 84.40% 15.60% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.40% 0.25% 0.00% NA
Temperate Japonica  767 48.50% 51.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 74.70% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721581014 A -> G LOC_Os07g36090.1 upstream_gene_variant ; 1682.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36100.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36110.1 upstream_gene_variant ; 1843.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36090.3 upstream_gene_variant ; 1682.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36090.2 upstream_gene_variant ; 1682.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36110.2 upstream_gene_variant ; 1843.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36080.1 downstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36080.2 downstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36080.3 downstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N
vg0721581014 A -> G LOC_Os07g36100-LOC_Os07g36110 intergenic_region ; MODIFIER silent_mutation Average:98.887; most accessible tissue: Minghui63 young leaf, score: 99.553 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721581014 A G -0.02 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721581014 NA 1.15E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581014 NA 5.43E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581014 NA 2.33E-08 mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581014 NA 6.74E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581014 NA 3.11E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721581014 NA 6.99E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251