\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721486566:

Variant ID: vg0721486566 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21486566
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAGTGAAAGCTCCGGTAGTAGCAAAGGCACTTTTAGAAGCTTCCTAAAGTATAGGAAGCTGAAATAAACACAATGGCACACATATATACCAATAACT[G/A]
AGGGACTTTATACCATACAGTCAATCAGGCAATGATTCAGAAGAGAAAAAGAATCAAGCAATCGCATTTTGTTAATATTCTGATCATGTTAGTTGTACAC

Reverse complement sequence

GTGTACAACTAACATGATCAGAATATTAACAAAATGCGATTGCTTGATTCTTTTTCTCTTCTGAATCATTGCCTGATTGACTGTATGGTATAAAGTCCCT[C/T]
AGTTATTGGTATATATGTGTGCCATTGTGTTTATTTCAGCTTCCTATACTTTAGGAAGCTTCTAAAAGTGCCTTTGCTACTACCGGAGCTTTCACTTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.00% 27.80% 15.62% 8.55% NA
All Indica  2759 72.00% 12.20% 14.90% 0.91% NA
All Japonica  1512 0.80% 55.00% 19.51% 24.74% NA
Aus  269 88.80% 4.80% 5.58% 0.74% NA
Indica I  595 57.00% 9.70% 30.59% 2.69% NA
Indica II  465 86.00% 6.50% 7.31% 0.22% NA
Indica III  913 75.00% 18.40% 6.57% 0.00% NA
Indica Intermediate  786 71.60% 10.20% 17.18% 1.02% NA
Temperate Japonica  767 1.20% 38.90% 14.99% 44.98% NA
Tropical Japonica  504 0.20% 84.30% 13.69% 1.79% NA
Japonica Intermediate  241 0.80% 44.80% 46.06% 8.30% NA
VI/Aromatic  96 6.20% 88.50% 5.21% 0.00% NA
Intermediate  90 27.80% 55.60% 13.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721486566 G -> DEL N N silent_mutation Average:10.853; most accessible tissue: Callus, score: 44.3 N N N N
vg0721486566 G -> A LOC_Os07g35920.4 downstream_gene_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:10.853; most accessible tissue: Callus, score: 44.3 N N N N
vg0721486566 G -> A LOC_Os07g35920.1 downstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:10.853; most accessible tissue: Callus, score: 44.3 N N N N
vg0721486566 G -> A LOC_Os07g35880-LOC_Os07g35920 intergenic_region ; MODIFIER silent_mutation Average:10.853; most accessible tissue: Callus, score: 44.3 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721486566 NA 1.47E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 4.45E-07 5.22E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 1.13E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 1.89E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 7.90E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 3.57E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 2.22E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 2.72E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 2.95E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 2.33E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 3.52E-06 NA mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 7.45E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 2.94E-08 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721486566 NA 1.45E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251