\
| Variant ID: vg0721449575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21449575 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.22, others allele: 0.00, population size: 92. )
TAAAATGAAACAACTATTTTCAACTGGGGCGGATGTAGGATTTGGGTGGTGTCTGGAAAAGGCTAGTGCCGTCCCTGGTCAGTTAAGGACCGAGCCATGA[G/A]
GTTAAGCATGAAACGACCCCCGTACAACCACACTTCTCGTATGGGTATAGACCTAGCGGAGTAGATAGATGAGCGGAGGCAGTATCCATGCATAGTGGTT
AACCACTATGCATGGATACTGCCTCCGCTCATCTATCTACTCCGCTAGGTCTATACCCATACGAGAAGTGTGGTTGTACGGGGGTCGTTTCATGCTTAAC[C/T]
TCATGGCTCGGTCCTTAACTGACCAGGGACGGCACTAGCCTTTTCCAGACACCACCCAAATCCTACATCCGCCCCAGTTGAAAATAGTTGTTTCATTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 27.00% | 3.72% | 14.92% | NA |
| All Indica | 2759 | 60.70% | 11.90% | 4.20% | 23.27% | NA |
| All Japonica | 1512 | 49.00% | 45.50% | 2.71% | 2.78% | NA |
| Aus | 269 | 27.10% | 62.10% | 5.58% | 5.20% | NA |
| Indica I | 595 | 82.40% | 3.50% | 1.01% | 13.11% | NA |
| Indica II | 465 | 38.50% | 9.20% | 2.80% | 49.46% | NA |
| Indica III | 913 | 55.40% | 20.40% | 7.01% | 17.20% | NA |
| Indica Intermediate | 786 | 63.50% | 9.80% | 4.20% | 22.52% | NA |
| Temperate Japonica | 767 | 26.70% | 62.70% | 5.35% | 5.22% | NA |
| Tropical Japonica | 504 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 31.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 39.60% | 59.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 38.90% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721449575 | G -> DEL | N | N | silent_mutation | Average:28.441; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0721449575 | G -> A | LOC_Os07g35810.1 | upstream_gene_variant ; 4752.0bp to feature; MODIFIER | silent_mutation | Average:28.441; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0721449575 | G -> A | LOC_Os07g35820.1 | upstream_gene_variant ; 1132.0bp to feature; MODIFIER | silent_mutation | Average:28.441; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0721449575 | G -> A | LOC_Os07g35820-LOC_Os07g35840 | intergenic_region ; MODIFIER | silent_mutation | Average:28.441; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721449575 | NA | 2.87E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 5.68E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 1.08E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | 2.54E-06 | 2.54E-06 | mr1779 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 9.92E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 2.06E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 5.15E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 5.28E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 7.18E-07 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 4.96E-10 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 1.58E-13 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721449575 | NA | 4.20E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |