\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721376419:

Variant ID: vg0721376419 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21376419
Reference Allele: AAlternative Allele: T,C,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAAAAAAATAATACTCCATCTGTTCTAAAATAAATACACACTCCAATTTAAATTTGAACTAATAAGGTGTACTTATTTTAGAACGAAGAGAGCAGCAG[A/T,C,G]
TGACACACTGGTTGAGAGATGAGCTGAGCGATATTTTGGCAAATTCCGAAATGAGATTTTCTCCAAGCCACTTACCTAGTCTTTTTAAGGCCCATTTTCG

Reverse complement sequence

CGAAAATGGGCCTTAAAAAGACTAGGTAAGTGGCTTGGAGAAAATCTCATTTCGGAATTTGCCAAAATATCGCTCAGCTCATCTCTCAACCAGTGTGTCA[T/A,G,C]
CTGCTGCTCTCTTCGTTCTAAAATAAGTACACCTTATTAGTTCAAATTTAAATTGGAGTGTGTATTTATTTTAGAACAGATGGAGTATTATTTTTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 21.20% 1.67% 4.19% C: 0.02%; G: 0.02%
All Indica  2759 85.10% 10.00% 2.21% 2.65% C: 0.04%; G: 0.04%
All Japonica  1512 50.50% 40.80% 0.99% 7.67% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 94.50% 3.00% 1.51% 0.84% C: 0.17%
Indica II  465 84.10% 15.10% 0.22% 0.65% NA
Indica III  913 79.10% 14.30% 4.60% 1.86% G: 0.11%
Indica Intermediate  786 85.50% 7.30% 1.15% 6.11% NA
Temperate Japonica  767 27.20% 64.70% 0.91% 7.17% NA
Tropical Japonica  504 85.50% 11.70% 0.99% 1.79% NA
Japonica Intermediate  241 51.50% 25.70% 1.24% 21.58% NA
VI/Aromatic  96 37.50% 55.20% 0.00% 7.29% NA
Intermediate  90 56.70% 37.80% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721376419 A -> DEL N N silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> G LOC_Os07g35680.1 upstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> G LOC_Os07g35690.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> G LOC_Os07g35690.2 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> G LOC_Os07g35680-LOC_Os07g35690 intergenic_region ; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> C LOC_Os07g35680.1 upstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> C LOC_Os07g35690.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> C LOC_Os07g35690.2 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> C LOC_Os07g35680-LOC_Os07g35690 intergenic_region ; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> T LOC_Os07g35680.1 upstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> T LOC_Os07g35690.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> T LOC_Os07g35690.2 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N
vg0721376419 A -> T LOC_Os07g35680-LOC_Os07g35690 intergenic_region ; MODIFIER silent_mutation Average:76.667; most accessible tissue: Zhenshan97 flag leaf, score: 93.682 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721376419 A C 0.03 0.0 0.01 -0.01 -0.01 -0.02
vg0721376419 A G 0.08 -0.05 -0.06 -0.02 -0.02 -0.02
vg0721376419 A T 0.09 0.01 0.01 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721376419 NA 7.33E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721376419 NA 9.90E-06 mr1702_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251