\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721118397:

Variant ID: vg0721118397 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21118397
Reference Allele: AAlternative Allele: T,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAAACAAAATATGTTTTTATATTTTGATATGAAGGGAGTACTAATACCAATAACCTGTGGAGCGCATAGTTTAGCGACTAGCGAGTAACTGAAGAGTC[A/T,G]
TTTTTTCATAACATAAGTTATGTGGTATACACATTTCTCTGTTTTTTTTTAAAATGTTCTAGTTAGTTTTACGAGGTCAAATAAGAAAAGTCAGGCTACA

Reverse complement sequence

TGTAGCCTGACTTTTCTTATTTGACCTCGTAAAACTAACTAGAACATTTTAAAAAAAAACAGAGAAATGTGTATACCACATAACTTATGTTATGAAAAAA[T/A,C]
GACTCTTCAGTTACTCGCTAGTCGCTAAACTATGCGCTCCACAGGTTATTGGTATTAGTACTCCCTTCATATCAAAATATAAAAACATATTTTGTTTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.40% 0.15% 0.00% G: 0.02%
All Indica  2759 88.30% 11.50% 0.25% 0.00% NA
All Japonica  1512 1.50% 98.40% 0.00% 0.00% G: 0.07%
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.00% 0.50% 0.00% NA
Indica II  465 81.10% 18.50% 0.43% 0.00% NA
Indica III  913 83.40% 16.50% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.30% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721118397 A -> G LOC_Os07g35290.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:53.778; most accessible tissue: Zhenshan97 root, score: 95.67 N N N N
vg0721118397 A -> G LOC_Os07g35280.1 intron_variant ; MODIFIER silent_mutation Average:53.778; most accessible tissue: Zhenshan97 root, score: 95.67 N N N N
vg0721118397 A -> T LOC_Os07g35290.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:53.778; most accessible tissue: Zhenshan97 root, score: 95.67 N N N N
vg0721118397 A -> T LOC_Os07g35280.1 intron_variant ; MODIFIER silent_mutation Average:53.778; most accessible tissue: Zhenshan97 root, score: 95.67 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721118397 A G 0.07 0.05 0.04 0.0 0.03 0.02
vg0721118397 A T 0.02 0.0 0.01 -0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721118397 NA 5.13E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 9.55E-07 7.71E-09 mr1082 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 2.06E-07 1.99E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.87E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.11E-14 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 7.61E-07 3.50E-08 mr1226 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 3.65E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 5.84E-06 NA mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 4.40E-06 1.87E-08 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.99E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.24E-12 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.88E-24 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 8.82E-06 2.85E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.00E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 5.12E-15 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 9.67E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 4.99E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 6.39E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.53E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.27E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 4.65E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 3.75E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.34E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.78E-24 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 4.43E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 9.16E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 9.83E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 1.96E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 3.46E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721118397 NA 2.43E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251