| Variant ID: vg0721027925 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21027925 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAGAACAGCTATAGAGGGGGGGTGAATATAGCAATTCAAATCTTGCCCCCGAAAATACTCATCAAGCCGGATTTCTCAAAAATCCTTACTAGAACCGCG[G/A]
CTATTAGAGAAGCCGGATCTAGAAAAGAAGAGAGAAAGAAATTCCCGAAACTAGAAGAGAAAGAGAAAAGGAATTTCCCAAACTAGAAGAGAGGTGAGGA
TCCTCACCTCTCTTCTAGTTTGGGAAATTCCTTTTCTCTTTCTCTTCTAGTTTCGGGAATTTCTTTCTCTCTTCTTTTCTAGATCCGGCTTCTCTAATAG[C/T]
CGCGGTTCTAGTAAGGATTTTTGAGAAATCCGGCTTGATGAGTATTTTCGGGGGCAAGATTTGAATTGCTATATTCACCCCCCCTCTATAGCTGTTCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 0.20% | 0.00% | 1.35% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.70% | 0.10% | 0.00% | 4.23% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 0.00% | 0.00% | 12.50% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721027925 | G -> DEL | N | N | silent_mutation | Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721027925 | G -> A | LOC_Os07g35100.1 | upstream_gene_variant ; 167.0bp to feature; MODIFIER | silent_mutation | Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721027925 | G -> A | LOC_Os07g35110.1 | upstream_gene_variant ; 1509.0bp to feature; MODIFIER | silent_mutation | Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721027925 | G -> A | LOC_Os07g35100-LOC_Os07g35110 | intergenic_region ; MODIFIER | silent_mutation | Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721027925 | NA | 7.94E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | NA | 2.24E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | NA | 7.50E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | 4.23E-06 | 8.91E-08 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | NA | 8.77E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | NA | 8.64E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721027925 | NA | 8.81E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |