\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721027925:

Variant ID: vg0721027925 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21027925
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGAACAGCTATAGAGGGGGGGTGAATATAGCAATTCAAATCTTGCCCCCGAAAATACTCATCAAGCCGGATTTCTCAAAAATCCTTACTAGAACCGCG[G/A]
CTATTAGAGAAGCCGGATCTAGAAAAGAAGAGAGAAAGAAATTCCCGAAACTAGAAGAGAAAGAGAAAAGGAATTTCCCAAACTAGAAGAGAGGTGAGGA

Reverse complement sequence

TCCTCACCTCTCTTCTAGTTTGGGAAATTCCTTTTCTCTTTCTCTTCTAGTTTCGGGAATTTCTTTCTCTCTTCTTTTCTAGATCCGGCTTCTCTAATAG[C/T]
CGCGGTTCTAGTAAGGATTTTTGAGAAATCCGGCTTGATGAGTATTTTCGGGGGCAAGATTTGAATTGCTATATTCACCCCCCCTCTATAGCTGTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 0.20% 0.00% 1.35% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 95.70% 0.10% 0.00% 4.23% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 87.50% 0.00% 0.00% 12.50% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721027925 G -> DEL N N silent_mutation Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0721027925 G -> A LOC_Os07g35100.1 upstream_gene_variant ; 167.0bp to feature; MODIFIER silent_mutation Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0721027925 G -> A LOC_Os07g35110.1 upstream_gene_variant ; 1509.0bp to feature; MODIFIER silent_mutation Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0721027925 G -> A LOC_Os07g35100-LOC_Os07g35110 intergenic_region ; MODIFIER silent_mutation Average:34.639; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721027925 NA 7.94E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 NA 2.24E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 NA 7.50E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 4.23E-06 8.91E-08 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 NA 8.77E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 NA 8.64E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721027925 NA 8.81E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251