Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720661357:

Variant ID: vg0720661357 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20661357
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAAAGTTGTAGATCTTGATGAGAGGATCAATTTTGTTGTTGACCATATTTCGATTTGAAATCATTTACTATCAGAAAATGTGTTATGACTAATAAAAT[A/G]
AATTATTATACAGCAGCTATATATTTTGTACTCACAAATATAAAGACTTATCTGGGAAATGGAAAAATAGTCATCGGTGACGGGCCTTAGTTCAAGCCCC

Reverse complement sequence

GGGGCTTGAACTAAGGCCCGTCACCGATGACTATTTTTCCATTTCCCAGATAAGTCTTTATATTTGTGAGTACAAAATATATAGCTGCTGTATAATAATT[T/C]
ATTTTATTAGTCATAACACATTTTCTGATAGTAAATGATTTCAAATCGAAATATGGTCAACAACAAAATTGATCCTCTCATCAAGATCTACAACTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	5.40%	10.16%	46.53%	NA
All Indica	2759	30.70%	2.10%	12.11%	55.06%	NA
All Japonica	1512	41.30%	11.40%	5.95%	41.34%	NA
Aus	269	76.60%	4.10%	17.47%	1.86%	NA
Indica I	595	15.00%	2.70%	13.28%	69.08%	NA
Indica II	465	22.80%	2.80%	11.83%	62.58%	NA
Indica III	913	46.90%	0.70%	10.51%	41.95%	NA
Indica Intermediate	786	28.50%	3.10%	13.23%	55.22%	NA
Temperate Japonica	767	41.50%	15.10%	5.87%	37.55%	NA
Tropical Japonica	504	49.80%	8.70%	3.97%	37.50%	NA
Japonica Intermediate	241	22.80%	5.40%	10.37%	61.41%	NA
VI/Aromatic	96	67.70%	9.40%	4.17%	18.75%	NA
Intermediate	90	55.60%	3.30%	5.56%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720661357	A -> DEL	N	N	silent_mutation	Average:8.427; most accessible tissue: Callus, score: 16.843	N	N	N	N
vg0720661357	A -> G	LOC_Os07g34470.1	upstream_gene_variant ; 3682.0bp to feature; MODIFIER	silent_mutation	Average:8.427; most accessible tissue: Callus, score: 16.843	N	N	N	N
vg0720661357	A -> G	LOC_Os07g34450.1	downstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:8.427; most accessible tissue: Callus, score: 16.843	N	N	N	N
vg0720661357	A -> G	LOC_Os07g34460.1	downstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:8.427; most accessible tissue: Callus, score: 16.843	N	N	N	N
vg0720661357	A -> G	LOC_Os07g34450-LOC_Os07g34460	intergenic_region ; MODIFIER	silent_mutation	Average:8.427; most accessible tissue: Callus, score: 16.843	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720661357	NA	3.77E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	2.08E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	1.80E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	3.20E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	6.63E-06	NA	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	4.45E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	1.68E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	2.39E-06	NA	mr1620	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	6.93E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	2.08E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	7.99E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	2.96E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	1.30E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	2.84E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	6.16E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	9.64E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357	NA	1.45E-08	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251