\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720661357:

Variant ID: vg0720661357 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20661357
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAGTTGTAGATCTTGATGAGAGGATCAATTTTGTTGTTGACCATATTTCGATTTGAAATCATTTACTATCAGAAAATGTGTTATGACTAATAAAAT[A/G]
AATTATTATACAGCAGCTATATATTTTGTACTCACAAATATAAAGACTTATCTGGGAAATGGAAAAATAGTCATCGGTGACGGGCCTTAGTTCAAGCCCC

Reverse complement sequence

GGGGCTTGAACTAAGGCCCGTCACCGATGACTATTTTTCCATTTCCCAGATAAGTCTTTATATTTGTGAGTACAAAATATATAGCTGCTGTATAATAATT[T/C]
ATTTTATTAGTCATAACACATTTTCTGATAGTAAATGATTTCAAATCGAAATATGGTCAACAACAAAATTGATCCTCTCATCAAGATCTACAACTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 5.40% 10.16% 46.53% NA
All Indica  2759 30.70% 2.10% 12.11% 55.06% NA
All Japonica  1512 41.30% 11.40% 5.95% 41.34% NA
Aus  269 76.60% 4.10% 17.47% 1.86% NA
Indica I  595 15.00% 2.70% 13.28% 69.08% NA
Indica II  465 22.80% 2.80% 11.83% 62.58% NA
Indica III  913 46.90% 0.70% 10.51% 41.95% NA
Indica Intermediate  786 28.50% 3.10% 13.23% 55.22% NA
Temperate Japonica  767 41.50% 15.10% 5.87% 37.55% NA
Tropical Japonica  504 49.80% 8.70% 3.97% 37.50% NA
Japonica Intermediate  241 22.80% 5.40% 10.37% 61.41% NA
VI/Aromatic  96 67.70% 9.40% 4.17% 18.75% NA
Intermediate  90 55.60% 3.30% 5.56% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720661357 A -> DEL N N silent_mutation Average:8.427; most accessible tissue: Callus, score: 16.843 N N N N
vg0720661357 A -> G LOC_Os07g34470.1 upstream_gene_variant ; 3682.0bp to feature; MODIFIER silent_mutation Average:8.427; most accessible tissue: Callus, score: 16.843 N N N N
vg0720661357 A -> G LOC_Os07g34450.1 downstream_gene_variant ; 1523.0bp to feature; MODIFIER silent_mutation Average:8.427; most accessible tissue: Callus, score: 16.843 N N N N
vg0720661357 A -> G LOC_Os07g34460.1 downstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:8.427; most accessible tissue: Callus, score: 16.843 N N N N
vg0720661357 A -> G LOC_Os07g34450-LOC_Os07g34460 intergenic_region ; MODIFIER silent_mutation Average:8.427; most accessible tissue: Callus, score: 16.843 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720661357 NA 3.77E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 2.08E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 1.80E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 3.20E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 6.63E-06 NA mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 4.45E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 1.68E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 2.39E-06 NA mr1620 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 6.93E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 2.08E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 7.99E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 2.96E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 1.30E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 2.84E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 6.16E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 9.64E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720661357 NA 1.45E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251