\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720636944:

Variant ID: vg0720636944 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 20636944
Reference Allele: CAlternative Allele: CGCG,T,CG
Primary Allele: CGCGSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCGGGATCCCGGCCTTTTCGTTGTCAGCCAATCGAAGCCTCAAGGTGTATGCCTCTCCTGGTAGTCCCTAGATGTTTCCCTAGAGAGTAGTCGAGCCG[C/CGCG,T,CG]
CGTTCACCGTAGGTCCTTTTCTGCCGCTGTCCTAAACCCACTGTCGCTGTCAACCATGGTGCCCGCTGCCTCCAGCCAACCCCGGCTGCGCTGCCACCTC

Reverse complement sequence

GAGGTGGCAGCGCAGCCGGGGTTGGCTGGAGGCAGCGGGCACCATGGTTGACAGCGACAGTGGGTTTAGGACAGCGGCAGAAAAGGACCTACGGTGAACG[G/CGCG,A,CG]
CGGCTCGACTACTCTCTAGGGAAACATCTAGGGACTACCAGGAGAGGCATACACCTTGAGGCTTCGATTGGCTGACAACGAAAAGGCCGGGATCCCGGTC

Allele Frequencies:

Populations Population SizeFrequency of CGCG(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 35.80% 0.34% 0.00% T: 0.17%; CG: 0.04%
All Indica  2759 93.30% 6.00% 0.47% 0.00% T: 0.25%
All Japonica  1512 18.10% 81.60% 0.07% 0.00% CG: 0.13%; T: 0.07%
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 97.00% 1.20% 1.34% 0.00% T: 0.50%
Indica II  465 96.80% 3.00% 0.00% 0.00% T: 0.22%
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 89.70% 9.30% 0.64% 0.00% T: 0.38%
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 44.80% 54.40% 0.20% 0.00% CG: 0.40%; T: 0.20%
Japonica Intermediate  241 15.40% 84.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720636944 C -> CGCG LOC_Os07g34410.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0720636944 C -> CGCG LOC_Os07g34400-LOC_Os07g34410 intergenic_region ; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0720636944 C -> CG LOC_Os07g34410.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0720636944 C -> CG LOC_Os07g34400-LOC_Os07g34410 intergenic_region ; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0720636944 C -> T LOC_Os07g34410.1 downstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg0720636944 C -> T LOC_Os07g34400-LOC_Os07g34410 intergenic_region ; MODIFIER silent_mutation Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720636944 4.65E-08 1.05E-06 mr1218 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 1.47E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 3.82E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 1.28E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 3.72E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 8.84E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 5.74E-35 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 3.24E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 6.75E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 1.70E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 1.52E-68 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720636944 NA 3.70E-18 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251