| Variant ID: vg0720636944 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 20636944 |
| Reference Allele: C | Alternative Allele: CGCG,T,CG |
| Primary Allele: CGCG | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACCGGGATCCCGGCCTTTTCGTTGTCAGCCAATCGAAGCCTCAAGGTGTATGCCTCTCCTGGTAGTCCCTAGATGTTTCCCTAGAGAGTAGTCGAGCCG[C/CGCG,T,CG]
CGTTCACCGTAGGTCCTTTTCTGCCGCTGTCCTAAACCCACTGTCGCTGTCAACCATGGTGCCCGCTGCCTCCAGCCAACCCCGGCTGCGCTGCCACCTC
GAGGTGGCAGCGCAGCCGGGGTTGGCTGGAGGCAGCGGGCACCATGGTTGACAGCGACAGTGGGTTTAGGACAGCGGCAGAAAAGGACCTACGGTGAACG[G/CGCG,A,CG]
CGGCTCGACTACTCTCTAGGGAAACATCTAGGGACTACCAGGAGAGGCATACACCTTGAGGCTTCGATTGGCTGACAACGAAAAGGCCGGGATCCCGGTC
| Populations | Population Size | Frequency of CGCG(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 35.80% | 0.34% | 0.00% | T: 0.17%; CG: 0.04% |
| All Indica | 2759 | 93.30% | 6.00% | 0.47% | 0.00% | T: 0.25% |
| All Japonica | 1512 | 18.10% | 81.60% | 0.07% | 0.00% | CG: 0.13%; T: 0.07% |
| Aus | 269 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 1.20% | 1.34% | 0.00% | T: 0.50% |
| Indica II | 465 | 96.80% | 3.00% | 0.00% | 0.00% | T: 0.22% |
| Indica III | 913 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 9.30% | 0.64% | 0.00% | T: 0.38% |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.80% | 54.40% | 0.20% | 0.00% | CG: 0.40%; T: 0.20% |
| Japonica Intermediate | 241 | 15.40% | 84.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720636944 | C -> CGCG | LOC_Os07g34410.1 | downstream_gene_variant ; 4554.0bp to feature; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg0720636944 | C -> CGCG | LOC_Os07g34400-LOC_Os07g34410 | intergenic_region ; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg0720636944 | C -> CG | LOC_Os07g34410.1 | downstream_gene_variant ; 4554.0bp to feature; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg0720636944 | C -> CG | LOC_Os07g34400-LOC_Os07g34410 | intergenic_region ; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg0720636944 | C -> T | LOC_Os07g34410.1 | downstream_gene_variant ; 4555.0bp to feature; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg0720636944 | C -> T | LOC_Os07g34400-LOC_Os07g34410 | intergenic_region ; MODIFIER | silent_mutation | Average:72.765; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720636944 | 4.65E-08 | 1.05E-06 | mr1218 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 1.47E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 3.82E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 1.28E-07 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 3.72E-09 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 8.84E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 5.74E-35 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 3.24E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 6.75E-15 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 1.70E-40 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 1.52E-68 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720636944 | NA | 3.70E-18 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |