Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0720600655:

Variant ID: vg0720600655 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20600655
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTATAAACTTTGTATACACATATACAAAGTTTATATGTATATATATATATACACACACACACGTATGCATATTGTATATATGTATATTTTTAAAATTT[G/A]
TATATATTTTTTATATACAAAGTTTGTATATGTATACATACAAAATATACCAATTTTATATACGCATAAATCCAAAGTTTATATATGTATACCTACAAAA

Reverse complement sequence

TTTTGTAGGTATACATATATAAACTTTGGATTTATGCGTATATAAAATTGGTATATTTTGTATGTATACATATACAAACTTTGTATATAAAAAATATATA[C/T]
AAATTTTAAAAATATACATATATACAATATGCATACGTGTGTGTGTGTATATATATATATACATATAAACTTTGTATATGTGTATACAAAGTTTATACGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	7.90%	0.17%	0.25%	NA
All Indica	2759	86.80%	12.90%	0.25%	0.00%	NA
All Japonica	1512	98.80%	0.30%	0.07%	0.79%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.10%	7.90%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	80.10%	19.80%	0.11%	0.00%	NA
Indica Intermediate	786	84.20%	15.00%	0.76%	0.00%	NA
Temperate Japonica	767	98.30%	0.10%	0.00%	1.56%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720600655	G -> DEL	N	N	silent_mutation	Average:46.718; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0720600655	G -> A	LOC_Os07g34370.1	upstream_gene_variant ; 451.0bp to feature; MODIFIER	silent_mutation	Average:46.718; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0720600655	G -> A	LOC_Os07g34380.1	downstream_gene_variant ; 2006.0bp to feature; MODIFIER	silent_mutation	Average:46.718; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0720600655	G -> A	LOC_Os07g34370-LOC_Os07g34380	intergenic_region ; MODIFIER	silent_mutation	Average:46.718; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720600655	1.48E-06	1.31E-06	mr1367	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720600655	8.49E-07	8.49E-07	mr1367	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720600655	NA	6.97E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251