\
| Variant ID: vg0720528667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20528667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTTGGGTGGTGTGGTTGAGTGAAGTGTACTTCACAGAACGGAGCGACGAATTAACTCATGATTTATTAATGATTTATTAAGTACTAGCCAAAATAATTT[G/A]
AAAAATAGATTAATATATTTTTTACAACTTTTGTATAAAAACACACATTTTACCAGTTTATGAAGCGTACGTGCGCGTGAAAAACGAAAGATGTGAGGTC
GACCTCACATCTTTCGTTTTTCACGCGCACGTACGCTTCATAAACTGGTAAAATGTGTGTTTTTATACAAAAGTTGTAAAAAATATATTAATCTATTTTT[C/T]
AAATTATTTTGGCTAGTACTTAATAAATCATTAATAAATCATGAGTTAATTCGTCGCTCCGTTCTGTGAAGTACACTTCACTCAACCACACCACCCAAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 9.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 75.50% | 24.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720528667 | G -> A | LOC_Os07g34280.1 | downstream_gene_variant ; 3311.0bp to feature; MODIFIER | silent_mutation | Average:44.826; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0720528667 | G -> A | LOC_Os07g34280-LOC_Os07g34290 | intergenic_region ; MODIFIER | silent_mutation | Average:44.826; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720528667 | 1.91E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 4.46E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | NA | 5.45E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 3.93E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 2.33E-07 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 4.95E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 1.57E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 3.97E-08 | NA | mr1107 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | NA | 4.83E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 4.80E-07 | NA | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 9.15E-08 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | NA | 2.47E-10 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 5.87E-08 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 2.98E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | 3.41E-06 | 5.94E-13 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720528667 | NA | 1.15E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |