\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720408008:

Variant ID: vg0720408008 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20408008
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.48, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTATGTTGAGAAACTTGTTTAGAATTCTCGTGACCATTAACATAATAGTTCCTCCGTTTCACAATGTAAATGTAAGACTTTCTAGCATTGTCCACATT[T/C]
ATATAGATGCTAATGAATCTAGACATTATTATATATATAGATTCATTAGCATCTATATGAATATGGACAATGCTAGAAAGTCTTACATTGTGAAACGAAG

Reverse complement sequence

CTTCGTTTCACAATGTAAGACTTTCTAGCATTGTCCATATTCATATAGATGCTAATGAATCTATATATATAATAATGTCTAGATTCATTAGCATCTATAT[A/G]
AATGTGGACAATGCTAGAAAGTCTTACATTTACATTGTGAAACGGAGGAACTATTATGTTAATGGTCACGAGAATTCTAAACAAGTTTCTCAACATAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.10% 0.34% 0.00% NA
All Indica  2759 87.20% 12.50% 0.25% 0.00% NA
All Japonica  1512 32.50% 67.30% 0.20% 0.00% NA
Aus  269 7.80% 91.80% 0.37% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 87.30% 12.30% 0.43% 0.00% NA
Indica III  913 85.30% 14.50% 0.22% 0.00% NA
Indica Intermediate  786 81.80% 17.80% 0.38% 0.00% NA
Temperate Japonica  767 27.60% 72.10% 0.26% 0.00% NA
Tropical Japonica  504 31.30% 68.50% 0.20% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720408008 T -> C LOC_Os07g34120.1 upstream_gene_variant ; 1895.0bp to feature; MODIFIER silent_mutation Average:26.721; most accessible tissue: Callus, score: 62.697 N N N N
vg0720408008 T -> C LOC_Os07g34130.1 upstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:26.721; most accessible tissue: Callus, score: 62.697 N N N N
vg0720408008 T -> C LOC_Os07g34120-LOC_Os07g34130 intergenic_region ; MODIFIER silent_mutation Average:26.721; most accessible tissue: Callus, score: 62.697 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720408008 NA 8.34E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 4.73E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 3.37E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 5.32E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 3.45E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 1.84E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 7.57E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 9.99E-08 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 5.77E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 1.49E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 3.44E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 8.06E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 3.24E-06 NA mr1083_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 1.81E-06 1.19E-09 mr1088_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 7.78E-08 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 9.91E-07 NA mr1104_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 2.65E-06 NA mr1107_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 3.24E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 2.81E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 1.29E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 4.14E-07 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 1.65E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 1.75E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 8.78E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008 NA 2.54E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251