Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720408008:

Variant ID: vg0720408008 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20408008
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.48, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTATGTTGAGAAACTTGTTTAGAATTCTCGTGACCATTAACATAATAGTTCCTCCGTTTCACAATGTAAATGTAAGACTTTCTAGCATTGTCCACATT[T/C]
ATATAGATGCTAATGAATCTAGACATTATTATATATATAGATTCATTAGCATCTATATGAATATGGACAATGCTAGAAAGTCTTACATTGTGAAACGAAG

Reverse complement sequence

CTTCGTTTCACAATGTAAGACTTTCTAGCATTGTCCATATTCATATAGATGCTAATGAATCTATATATATAATAATGTCTAGATTCATTAGCATCTATAT[A/G]
AATGTGGACAATGCTAGAAAGTCTTACATTTACATTGTGAAACGGAGGAACTATTATGTTAATGGTCACGAGAATTCTAAACAAGTTTCTCAACATAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.10%	0.34%	0.00%	NA
All Indica	2759	87.20%	12.50%	0.25%	0.00%	NA
All Japonica	1512	32.50%	67.30%	0.20%	0.00%	NA
Aus	269	7.80%	91.80%	0.37%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	87.30%	12.30%	0.43%	0.00%	NA
Indica III	913	85.30%	14.50%	0.22%	0.00%	NA
Indica Intermediate	786	81.80%	17.80%	0.38%	0.00%	NA
Temperate Japonica	767	27.60%	72.10%	0.26%	0.00%	NA
Tropical Japonica	504	31.30%	68.50%	0.20%	0.00%	NA
Japonica Intermediate	241	50.20%	49.80%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	55.60%	40.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720408008	T -> C	LOC_Os07g34120.1	upstream_gene_variant ; 1895.0bp to feature; MODIFIER	silent_mutation	Average:26.721; most accessible tissue: Callus, score: 62.697	N	N	N	N
vg0720408008	T -> C	LOC_Os07g34130.1	upstream_gene_variant ; 2543.0bp to feature; MODIFIER	silent_mutation	Average:26.721; most accessible tissue: Callus, score: 62.697	N	N	N	N
vg0720408008	T -> C	LOC_Os07g34120-LOC_Os07g34130	intergenic_region ; MODIFIER	silent_mutation	Average:26.721; most accessible tissue: Callus, score: 62.697	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720408008	NA	8.34E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	4.73E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	3.37E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	5.32E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	3.45E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	1.84E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	7.57E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	9.99E-08	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	5.77E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	1.49E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	3.44E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	8.06E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	3.24E-06	NA	mr1083_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	1.81E-06	1.19E-09	mr1088_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	7.78E-08	NA	mr1103_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	9.91E-07	NA	mr1104_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	2.65E-06	NA	mr1107_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	3.24E-07	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	2.81E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	1.29E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	4.14E-07	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	1.65E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	1.75E-06	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	8.78E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720408008	NA	2.54E-08	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251