\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720403149:

Variant ID: vg0720403149 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20403149
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGGGTTTCCAAAATATGTGAGTTTTTTTTTCGCAATGGAATATTTCAGTTCACTGCAACATTAGATCTATACATAGTGAAATATTATGAGTGCACTAG[G/A]
TGAAACATTTTTGGTGAAACATTTTTGGTGAAACAAAAAATAAACCAAACTCCCTTAATAGGGGGTTTCTAAAATATGTGAATGATTTGTTACAATAGAG

Reverse complement sequence

CTCTATTGTAACAAATCATTCACATATTTTAGAAACCCCCTATTAAGGGAGTTTGGTTTATTTTTTGTTTCACCAAAAATGTTTCACCAAAAATGTTTCA[C/T]
CTAGTGCACTCATAATATTTCACTATGTATAGATCTAATGTTGCAGTGAACTGAAATATTCCATTGCGAAAAAAAAACTCACATATTTTGGAAACCCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 1.70% 0.74% 0.53% NA
All Indica  2759 98.60% 0.80% 0.65% 0.00% NA
All Japonica  1512 95.70% 1.90% 0.79% 1.59% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 97.40% 0.90% 1.72% 0.00% NA
Indica III  913 98.80% 0.80% 0.44% 0.00% NA
Indica Intermediate  786 98.50% 0.90% 0.64% 0.00% NA
Temperate Japonica  767 97.90% 0.10% 0.65% 1.30% NA
Tropical Japonica  504 92.30% 5.40% 1.19% 1.19% NA
Japonica Intermediate  241 95.90% 0.40% 0.41% 3.32% NA
VI/Aromatic  96 93.80% 3.10% 3.12% 0.00% NA
Intermediate  90 93.30% 3.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720403149 G -> DEL N N silent_mutation Average:65.173; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0720403149 G -> A LOC_Os07g34120.1 downstream_gene_variant ; 1239.0bp to feature; MODIFIER silent_mutation Average:65.173; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0720403149 G -> A LOC_Os07g34110-LOC_Os07g34120 intergenic_region ; MODIFIER silent_mutation Average:65.173; most accessible tissue: Minghui63 root, score: 83.939 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720403149 NA 2.82E-09 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 6.67E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.11E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.94E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 6.16E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.35E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 7.02E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.46E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 8.12E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 6.70E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.44E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 4.24E-08 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 4.15E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 9.98E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.01E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.30E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 5.45E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 8.24E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.53E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.97E-11 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.55E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 8.72E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 2.60E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.48E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 3.95E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149 NA 1.07E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251