Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720403149:

Variant ID: vg0720403149 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20403149
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGGTTTCCAAAATATGTGAGTTTTTTTTTCGCAATGGAATATTTCAGTTCACTGCAACATTAGATCTATACATAGTGAAATATTATGAGTGCACTAG[G/A]
TGAAACATTTTTGGTGAAACATTTTTGGTGAAACAAAAAATAAACCAAACTCCCTTAATAGGGGGTTTCTAAAATATGTGAATGATTTGTTACAATAGAG

Reverse complement sequence

CTCTATTGTAACAAATCATTCACATATTTTAGAAACCCCCTATTAAGGGAGTTTGGTTTATTTTTTGTTTCACCAAAAATGTTTCACCAAAAATGTTTCA[C/T]
CTAGTGCACTCATAATATTTCACTATGTATAGATCTAATGTTGCAGTGAACTGAAATATTCCATTGCGAAAAAAAAACTCACATATTTTGGAAACCCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	1.70%	0.74%	0.53%	NA
All Indica	2759	98.60%	0.80%	0.65%	0.00%	NA
All Japonica	1512	95.70%	1.90%	0.79%	1.59%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	97.40%	0.90%	1.72%	0.00%	NA
Indica III	913	98.80%	0.80%	0.44%	0.00%	NA
Indica Intermediate	786	98.50%	0.90%	0.64%	0.00%	NA
Temperate Japonica	767	97.90%	0.10%	0.65%	1.30%	NA
Tropical Japonica	504	92.30%	5.40%	1.19%	1.19%	NA
Japonica Intermediate	241	95.90%	0.40%	0.41%	3.32%	NA
VI/Aromatic	96	93.80%	3.10%	3.12%	0.00%	NA
Intermediate	90	93.30%	3.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720403149	G -> DEL	N	N	silent_mutation	Average:65.173; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0720403149	G -> A	LOC_Os07g34120.1	downstream_gene_variant ; 1239.0bp to feature; MODIFIER	silent_mutation	Average:65.173; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0720403149	G -> A	LOC_Os07g34110-LOC_Os07g34120	intergenic_region ; MODIFIER	silent_mutation	Average:65.173; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720403149	NA	2.82E-09	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	6.67E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.11E-08	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.94E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	6.16E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.35E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	7.02E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.46E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	8.12E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	6.70E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.44E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	4.24E-08	mr1642	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	4.15E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	9.98E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.01E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.30E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	5.45E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	8.24E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.53E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.97E-11	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.55E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	8.72E-09	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	2.60E-11	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.48E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	3.95E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720403149	NA	1.07E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251