Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720389845:

Variant ID: vg0720389845 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 20389845
Reference Allele: TC	Alternative Allele: CC,T
Primary Allele: CC	Secondary Allele: TC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAACAATTGGGTTTTTTGTTTAGTTGAATTTTGCCAAGTGCCATTCACCTTGTCTCTAGTCCTCGCTCGATTAGTCGGCGACTATTGATTCAGAGCC[TC/CC,T]
CAATAGTTGGTGTGTTGATTTGCCGGGTCGATTAGATCTACCATTTCAATCGCAACTATTCCTTTGTGCTTAATTACCTATTCACAATATTTAGATTGCA

Reverse complement sequence

TGCAATCTAAATATTGTGAATAGGTAATTAAGCACAAAGGAATAGTTGCGATTGAAATGGTAGATCTAATCGACCCGGCAAATCAACACACCAACTATTG[GA/GG,A]
GGCTCTGAATCAATAGTCGCCGACTAATCGAGCGAGGACTAGAGACAAGGTGAATGGCACTTGGCAAAATTCAACTAAACAAAAAACCCAATTGTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of CC(primary allele)	Frequency of TC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	28.20%	0.59%	0.42%	NA
All Indica	2759	93.80%	4.50%	1.01%	0.72%	NA
All Japonica	1512	37.70%	62.30%	0.00%	0.00%	NA
Aus	269	8.60%	91.40%	0.00%	0.00%	NA
Indica I	595	95.50%	1.00%	2.02%	1.51%	NA
Indica II	465	91.60%	7.70%	0.22%	0.43%	NA
Indica III	913	97.90%	0.90%	0.66%	0.55%	NA
Indica Intermediate	786	88.90%	9.40%	1.15%	0.51%	NA
Temperate Japonica	767	8.10%	91.90%	0.00%	0.00%	NA
Tropical Japonica	504	86.50%	13.50%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	70.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720389845	TC -> DEL	N	N	silent_mutation	Average:38.064; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0720389845	TC -> CC	LOC_Os07g34110.1	downstream_gene_variant ; 2557.0bp to feature; MODIFIER	silent_mutation	Average:38.064; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0720389845	TC -> CC	LOC_Os07g34100.1	intron_variant ; MODIFIER	silent_mutation	Average:38.064; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0720389845	TC -> T	LOC_Os07g34110.1	downstream_gene_variant ; 2556.0bp to feature; MODIFIER	N	Average:38.064; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0720389845	TC -> T	LOC_Os07g34100.1	intron_variant ; MODIFIER	N	Average:38.064; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720389845	NA	3.80E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	4.44E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	6.26E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.48E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.68E-14	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	2.40E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.17E-14	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	5.19E-17	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	8.51E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.60E-13	mr1228_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.66E-10	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.70E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	8.51E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.25E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	1.98E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	9.87E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	7.93E-22	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	9.69E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720389845	NA	2.49E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251