\
| Variant ID: vg0720001612 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 20001612 |
| Reference Allele: G | Alternative Allele: T,GTT |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGGGCTTATGATTAGGGTTTAAAATTTTGGTTCGAAATTTCGGTAATTTTCGCCCCACCCCCCCCACCAGCATGCTCAAATCTCATTCGAAATTTTCGG[G/T,GTT]
TTTTTTTGCATTTTTTGCGAATTTGGTCCAATTGTATTCAAATTCATTCAAAATCAGTCAAAAGTTCAAATAATTTTGGTCAAAAATTTCCGAAATTTCT
AGAAATTTCGGAAATTTTTGACCAAAATTATTTGAACTTTTGACTGATTTTGAATGAATTTGAATACAATTGGACCAAATTCGCAAAAAATGCAAAAAAA[C/A,AAC]
CCGAAAATTTCGAATGAGATTTGAGCATGCTGGTGGGGGGGGTGGGGCGAAAATTACCGAAATTTCGAACCAAAATTTTAAACCCTAATCATAAGCCCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 20.50% | 0.04% | 3.47% | GTT: 5.95% |
| All Indica | 2759 | 79.90% | 19.40% | 0.00% | 0.00% | GTT: 0.69% |
| All Japonica | 1512 | 63.20% | 9.70% | 0.00% | 10.71% | GTT: 16.34% |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 5.60% | 0.00% | 0.00% | GTT: 1.51% |
| Indica III | 913 | 59.00% | 40.50% | 0.00% | 0.00% | GTT: 0.44% |
| Indica Intermediate | 786 | 82.10% | 16.90% | 0.00% | 0.00% | GTT: 1.02% |
| Temperate Japonica | 767 | 95.30% | 2.60% | 0.00% | 0.13% | GTT: 1.96% |
| Tropical Japonica | 504 | 12.10% | 20.40% | 0.00% | 31.35% | GTT: 36.11% |
| Japonica Intermediate | 241 | 68.00% | 10.00% | 0.00% | 1.24% | GTT: 20.75% |
| VI/Aromatic | 96 | 90.60% | 6.20% | 1.04% | 0.00% | GTT: 2.08% |
| Intermediate | 90 | 64.40% | 17.80% | 1.11% | 2.22% | GTT: 14.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720001612 | G -> DEL | N | N | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> GTT | LOC_Os07g33470.1 | upstream_gene_variant ; 1866.0bp to feature; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> GTT | LOC_Os07g33460.1 | downstream_gene_variant ; 1300.0bp to feature; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> GTT | LOC_Os07g33460-LOC_Os07g33470 | intergenic_region ; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> T | LOC_Os07g33470.1 | upstream_gene_variant ; 1867.0bp to feature; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> T | LOC_Os07g33460.1 | downstream_gene_variant ; 1299.0bp to feature; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| vg0720001612 | G -> T | LOC_Os07g33460-LOC_Os07g33470 | intergenic_region ; MODIFIER | silent_mutation | Average:33.137; most accessible tissue: Callus, score: 38.515 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720001612 | NA | 1.34E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 6.51E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 2.71E-06 | NA | mr1438 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 3.56E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 6.90E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 6.56E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 1.45E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 5.57E-08 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | 2.83E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 7.72E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 6.43E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 2.91E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 1.33E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001612 | NA | 3.89E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |