\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720001612:

Variant ID: vg0720001612 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 20001612
Reference Allele: GAlternative Allele: T,GTT
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGGCTTATGATTAGGGTTTAAAATTTTGGTTCGAAATTTCGGTAATTTTCGCCCCACCCCCCCCACCAGCATGCTCAAATCTCATTCGAAATTTTCGG[G/T,GTT]
TTTTTTTGCATTTTTTGCGAATTTGGTCCAATTGTATTCAAATTCATTCAAAATCAGTCAAAAGTTCAAATAATTTTGGTCAAAAATTTCCGAAATTTCT

Reverse complement sequence

AGAAATTTCGGAAATTTTTGACCAAAATTATTTGAACTTTTGACTGATTTTGAATGAATTTGAATACAATTGGACCAAATTCGCAAAAAATGCAAAAAAA[C/A,AAC]
CCGAAAATTTCGAATGAGATTTGAGCATGCTGGTGGGGGGGGTGGGGCGAAAATTACCGAAATTTCGAACCAAAATTTTAAACCCTAATCATAAGCCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 20.50% 0.04% 3.47% GTT: 5.95%
All Indica  2759 79.90% 19.40% 0.00% 0.00% GTT: 0.69%
All Japonica  1512 63.20% 9.70% 0.00% 10.71% GTT: 16.34%
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 92.90% 5.60% 0.00% 0.00% GTT: 1.51%
Indica III  913 59.00% 40.50% 0.00% 0.00% GTT: 0.44%
Indica Intermediate  786 82.10% 16.90% 0.00% 0.00% GTT: 1.02%
Temperate Japonica  767 95.30% 2.60% 0.00% 0.13% GTT: 1.96%
Tropical Japonica  504 12.10% 20.40% 0.00% 31.35% GTT: 36.11%
Japonica Intermediate  241 68.00% 10.00% 0.00% 1.24% GTT: 20.75%
VI/Aromatic  96 90.60% 6.20% 1.04% 0.00% GTT: 2.08%
Intermediate  90 64.40% 17.80% 1.11% 2.22% GTT: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720001612 G -> DEL N N silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> GTT LOC_Os07g33470.1 upstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> GTT LOC_Os07g33460.1 downstream_gene_variant ; 1300.0bp to feature; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> GTT LOC_Os07g33460-LOC_Os07g33470 intergenic_region ; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> T LOC_Os07g33470.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> T LOC_Os07g33460.1 downstream_gene_variant ; 1299.0bp to feature; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N
vg0720001612 G -> T LOC_Os07g33460-LOC_Os07g33470 intergenic_region ; MODIFIER silent_mutation Average:33.137; most accessible tissue: Callus, score: 38.515 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720001612 NA 1.34E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 6.51E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 2.71E-06 NA mr1438 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 3.56E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 6.90E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 6.56E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 1.45E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 5.57E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 2.83E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 7.72E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 6.43E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 2.91E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 1.33E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612 NA 3.89E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251