\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719884010:

Variant ID: vg0719884010 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19884010
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATAAATATACAAATTCAAATTGGAAAAACAAAAATAATAATTTTGGTTGCGAATTATACGTTCTCTTCATAGTTAAATTTGTTATTTTTATATTGGGG[C/T,A]
ATTTATAAATTTGCCACCGTTTTTTTCAGTTTTGCAAGGATGCGTCCTAGTGGAATTTTTACAATTTTCTAGTGACAATCTTACAATAATAATTCAAAGC

Reverse complement sequence

GCTTTGAATTATTATTGTAAGATTGTCACTAGAAAATTGTAAAAATTCCACTAGGACGCATCCTTGCAAAACTGAAAAAAACGGTGGCAAATTTATAAAT[G/A,T]
CCCCAATATAAAAATAACAAATTTAACTATGAAGAGAACGTATAATTCGCAACCAAAATTATTATTTTTGTTTTTCCAATTTGAATTTGTATATTTATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 15.50% 1.42% 0.00% A: 0.40%
All Indica  2759 89.30% 10.40% 0.11% 0.00% A: 0.18%
All Japonica  1512 67.80% 28.00% 4.23% 0.00% NA
Aus  269 95.20% 0.00% 0.00% 0.00% A: 4.83%
Indica I  595 91.80% 8.10% 0.00% 0.00% A: 0.17%
Indica II  465 95.90% 3.70% 0.22% 0.00% A: 0.22%
Indica III  913 85.10% 14.90% 0.00% 0.00% NA
Indica Intermediate  786 88.40% 10.90% 0.25% 0.00% A: 0.38%
Temperate Japonica  767 86.70% 7.00% 6.26% 0.00% NA
Tropical Japonica  504 41.50% 57.90% 0.60% 0.00% NA
Japonica Intermediate  241 62.70% 32.00% 5.39% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719884010 C -> A LOC_Os07g33270.1 downstream_gene_variant ; 3167.0bp to feature; MODIFIER silent_mutation Average:41.811; most accessible tissue: Callus, score: 74.066 N N N N
vg0719884010 C -> A LOC_Os07g33260-LOC_Os07g33270 intergenic_region ; MODIFIER silent_mutation Average:41.811; most accessible tissue: Callus, score: 74.066 N N N N
vg0719884010 C -> T LOC_Os07g33270.1 downstream_gene_variant ; 3167.0bp to feature; MODIFIER silent_mutation Average:41.811; most accessible tissue: Callus, score: 74.066 N N N N
vg0719884010 C -> T LOC_Os07g33260-LOC_Os07g33270 intergenic_region ; MODIFIER silent_mutation Average:41.811; most accessible tissue: Callus, score: 74.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719884010 NA 3.91E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 6.47E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 2.07E-06 7.42E-11 mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 5.58E-17 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 6.73E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 5.79E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 2.50E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 2.47E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 1.04E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010 NA 8.71E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251