Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0719884010:

Variant ID: vg0719884010 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19884010
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATAAATATACAAATTCAAATTGGAAAAACAAAAATAATAATTTTGGTTGCGAATTATACGTTCTCTTCATAGTTAAATTTGTTATTTTTATATTGGGG[C/T,A]
ATTTATAAATTTGCCACCGTTTTTTTCAGTTTTGCAAGGATGCGTCCTAGTGGAATTTTTACAATTTTCTAGTGACAATCTTACAATAATAATTCAAAGC

Reverse complement sequence

GCTTTGAATTATTATTGTAAGATTGTCACTAGAAAATTGTAAAAATTCCACTAGGACGCATCCTTGCAAAACTGAAAAAAACGGTGGCAAATTTATAAAT[G/A,T]
CCCCAATATAAAAATAACAAATTTAACTATGAAGAGAACGTATAATTCGCAACCAAAATTATTATTTTTGTTTTTCCAATTTGAATTTGTATATTTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	15.50%	1.42%	0.00%	A: 0.40%
All Indica	2759	89.30%	10.40%	0.11%	0.00%	A: 0.18%
All Japonica	1512	67.80%	28.00%	4.23%	0.00%	NA
Aus	269	95.20%	0.00%	0.00%	0.00%	A: 4.83%
Indica I	595	91.80%	8.10%	0.00%	0.00%	A: 0.17%
Indica II	465	95.90%	3.70%	0.22%	0.00%	A: 0.22%
Indica III	913	85.10%	14.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.40%	10.90%	0.25%	0.00%	A: 0.38%
Temperate Japonica	767	86.70%	7.00%	6.26%	0.00%	NA
Tropical Japonica	504	41.50%	57.90%	0.60%	0.00%	NA
Japonica Intermediate	241	62.70%	32.00%	5.39%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	0.00%	0.00%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719884010	C -> A	LOC_Os07g33270.1	downstream_gene_variant ; 3167.0bp to feature; MODIFIER	silent_mutation	Average:41.811; most accessible tissue: Callus, score: 74.066	N	N	N	N
vg0719884010	C -> A	LOC_Os07g33260-LOC_Os07g33270	intergenic_region ; MODIFIER	silent_mutation	Average:41.811; most accessible tissue: Callus, score: 74.066	N	N	N	N
vg0719884010	C -> T	LOC_Os07g33270.1	downstream_gene_variant ; 3167.0bp to feature; MODIFIER	silent_mutation	Average:41.811; most accessible tissue: Callus, score: 74.066	N	N	N	N
vg0719884010	C -> T	LOC_Os07g33260-LOC_Os07g33270	intergenic_region ; MODIFIER	silent_mutation	Average:41.811; most accessible tissue: Callus, score: 74.066	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719884010	NA	3.91E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	6.47E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	2.07E-06	7.42E-11	mr1769	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	5.58E-17	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	6.73E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	5.79E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	2.50E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	2.47E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	1.04E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719884010	NA	8.71E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251