\
| Variant ID: vg0719727009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19727009 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 103. )
TGGTTATCATAAATAAGAGCAATACCAGCTTCGGCCAACAAGATGTAGGGTTATTACCTGACAACTCATGGGCCCAAACCTGTATAAAAATCCTCGTCTC[C/T]
ATCTCTTTTACCTCAGTCTCGCATATATCCTAGCACCGACGATCCCCATACTGTCCAAATACCGTAGTCGAGACATCAAACGTCGACAGTGGCGCGCCAG
CTGGCGCGCCACTGTCGACGTTTGATGTCTCGACTACGGTATTTGGACAGTATGGGGATCGTCGGTGCTAGGATATATGCGAGACTGAGGTAAAAGAGAT[G/A]
GAGACGAGGATTTTTATACAGGTTTGGGCCCATGAGTTGTCAGGTAATAACCCTACATCTTGTTGGCCGAAGCTGGTATTGCTCTTATTTATGATAACCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 25.00% | 6.47% | 5.14% | NA |
| All Indica | 2759 | 78.80% | 6.60% | 9.39% | 5.18% | NA |
| All Japonica | 1512 | 35.30% | 63.90% | 0.20% | 0.66% | NA |
| Aus | 269 | 82.20% | 1.50% | 7.81% | 8.55% | NA |
| Indica I | 595 | 79.20% | 1.50% | 17.14% | 2.18% | NA |
| Indica II | 465 | 72.70% | 9.90% | 10.54% | 6.88% | NA |
| Indica III | 913 | 84.40% | 5.70% | 3.94% | 5.91% | NA |
| Indica Intermediate | 786 | 75.70% | 9.50% | 9.16% | 5.60% | NA |
| Temperate Japonica | 767 | 3.70% | 95.80% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 86.30% | 12.70% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 29.00% | 69.30% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 17.70% | 3.10% | 12.50% | 66.67% | NA |
| Intermediate | 90 | 54.40% | 30.00% | 12.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719727009 | C -> DEL | N | N | silent_mutation | Average:14.093; most accessible tissue: Callus, score: 32.254 | N | N | N | N |
| vg0719727009 | C -> T | LOC_Os07g33010.1 | upstream_gene_variant ; 3395.0bp to feature; MODIFIER | silent_mutation | Average:14.093; most accessible tissue: Callus, score: 32.254 | N | N | N | N |
| vg0719727009 | C -> T | LOC_Os07g33020.1 | upstream_gene_variant ; 297.0bp to feature; MODIFIER | silent_mutation | Average:14.093; most accessible tissue: Callus, score: 32.254 | N | N | N | N |
| vg0719727009 | C -> T | LOC_Os07g33030.1 | upstream_gene_variant ; 4836.0bp to feature; MODIFIER | silent_mutation | Average:14.093; most accessible tissue: Callus, score: 32.254 | N | N | N | N |
| vg0719727009 | C -> T | LOC_Os07g33010-LOC_Os07g33020 | intergenic_region ; MODIFIER | silent_mutation | Average:14.093; most accessible tissue: Callus, score: 32.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719727009 | NA | 7.45E-10 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 5.62E-09 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.52E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.55E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 4.08E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 2.61E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 3.12E-11 | mr1679 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.09E-08 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.03E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 3.14E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.21E-10 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 1.85E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719727009 | NA | 3.77E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |