\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719727009:

Variant ID: vg0719727009 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19727009
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTATCATAAATAAGAGCAATACCAGCTTCGGCCAACAAGATGTAGGGTTATTACCTGACAACTCATGGGCCCAAACCTGTATAAAAATCCTCGTCTC[C/T]
ATCTCTTTTACCTCAGTCTCGCATATATCCTAGCACCGACGATCCCCATACTGTCCAAATACCGTAGTCGAGACATCAAACGTCGACAGTGGCGCGCCAG

Reverse complement sequence

CTGGCGCGCCACTGTCGACGTTTGATGTCTCGACTACGGTATTTGGACAGTATGGGGATCGTCGGTGCTAGGATATATGCGAGACTGAGGTAAAAGAGAT[G/A]
GAGACGAGGATTTTTATACAGGTTTGGGCCCATGAGTTGTCAGGTAATAACCCTACATCTTGTTGGCCGAAGCTGGTATTGCTCTTATTTATGATAACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 25.00% 6.47% 5.14% NA
All Indica  2759 78.80% 6.60% 9.39% 5.18% NA
All Japonica  1512 35.30% 63.90% 0.20% 0.66% NA
Aus  269 82.20% 1.50% 7.81% 8.55% NA
Indica I  595 79.20% 1.50% 17.14% 2.18% NA
Indica II  465 72.70% 9.90% 10.54% 6.88% NA
Indica III  913 84.40% 5.70% 3.94% 5.91% NA
Indica Intermediate  786 75.70% 9.50% 9.16% 5.60% NA
Temperate Japonica  767 3.70% 95.80% 0.26% 0.26% NA
Tropical Japonica  504 86.30% 12.70% 0.20% 0.79% NA
Japonica Intermediate  241 29.00% 69.30% 0.00% 1.66% NA
VI/Aromatic  96 17.70% 3.10% 12.50% 66.67% NA
Intermediate  90 54.40% 30.00% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719727009 C -> DEL N N silent_mutation Average:14.093; most accessible tissue: Callus, score: 32.254 N N N N
vg0719727009 C -> T LOC_Os07g33010.1 upstream_gene_variant ; 3395.0bp to feature; MODIFIER silent_mutation Average:14.093; most accessible tissue: Callus, score: 32.254 N N N N
vg0719727009 C -> T LOC_Os07g33020.1 upstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:14.093; most accessible tissue: Callus, score: 32.254 N N N N
vg0719727009 C -> T LOC_Os07g33030.1 upstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:14.093; most accessible tissue: Callus, score: 32.254 N N N N
vg0719727009 C -> T LOC_Os07g33010-LOC_Os07g33020 intergenic_region ; MODIFIER silent_mutation Average:14.093; most accessible tissue: Callus, score: 32.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719727009 NA 7.45E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 5.62E-09 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.52E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.55E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 4.08E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 2.61E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 3.12E-11 mr1679 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.09E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.03E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 3.14E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.21E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 1.85E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727009 NA 3.77E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251