\
| Variant ID: vg0719725023 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19725023 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 109. )
ATCGAGAAGAAAAGAGAAGAGAGAAAAGAAAGCGGGTTACAGATTTGTAGGCAGCTGCAACACGGACCCCAAGCCGTTGTGTGTGTATAAGAGGTAGGAC[A/C]
GTGTATTAATGGTGTAGTATATTTTTATAGGTAACTATTGCATGAATGAGTTATTAGATTAGCTATAGATGATTTGGAGCTAATATTTGGCTATACTATT
AATAGTATAGCCAAATATTAGCTCCAAATCATCTATAGCTAATCTAATAACTCATTCATGCAATAGTTACCTATAAAAATATACTACACCATTAATACAC[T/G]
GTCCTACCTCTTATACACACACAACGGCTTGGGGTCCGTGTTGCAGCTGCCTACAAATCTGTAACCCGCTTTCTTTTCTCTCTTCTCTTTTCTTCTCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.10% | 13.90% | 0.36% | 64.73% | NA |
| All Indica | 2759 | 2.80% | 1.30% | 0.58% | 95.36% | NA |
| All Japonica | 1512 | 58.30% | 40.00% | 0.00% | 1.65% | NA |
| Aus | 269 | 0.00% | 0.40% | 0.00% | 99.63% | NA |
| Indica I | 595 | 0.30% | 1.20% | 0.17% | 98.32% | NA |
| Indica II | 465 | 3.40% | 1.70% | 0.43% | 94.41% | NA |
| Indica III | 913 | 2.80% | 0.70% | 0.55% | 95.95% | NA |
| Indica Intermediate | 786 | 4.20% | 1.80% | 1.02% | 93.00% | NA |
| Temperate Japonica | 767 | 45.60% | 52.40% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.10% | 59.80% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 9.40% | 0.00% | 1.04% | 89.58% | NA |
| Intermediate | 90 | 30.00% | 15.60% | 0.00% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719725023 | A -> DEL | N | N | silent_mutation | Average:10.682; most accessible tissue: Callus, score: 56.204 | N | N | N | N |
| vg0719725023 | A -> C | LOC_Os07g33010.1 | upstream_gene_variant ; 1409.0bp to feature; MODIFIER | silent_mutation | Average:10.682; most accessible tissue: Callus, score: 56.204 | N | N | N | N |
| vg0719725023 | A -> C | LOC_Os07g33020.1 | upstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:10.682; most accessible tissue: Callus, score: 56.204 | N | N | N | N |
| vg0719725023 | A -> C | LOC_Os07g33010-LOC_Os07g33020 | intergenic_region ; MODIFIER | silent_mutation | Average:10.682; most accessible tissue: Callus, score: 56.204 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719725023 | 6.19E-06 | NA | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719725023 | NA | 7.53E-06 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 2.66E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 2.30E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 6.58E-06 | NA | mr1070_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 2.34E-06 | NA | mr1076_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 5.49E-06 | NA | mr1082_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 1.16E-06 | NA | mr1085_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 7.96E-06 | 7.95E-06 | mr1126_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 6.14E-06 | mr1154_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 2.84E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 7.28E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 3.01E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 2.81E-06 | 4.60E-07 | mr1404_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 1.85E-06 | 1.25E-07 | mr1620_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 9.55E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | 2.95E-06 | 2.95E-06 | mr1765_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719725023 | NA | 1.21E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |