\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719725023:

Variant ID: vg0719725023 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19725023
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGAGAAGAAAAGAGAAGAGAGAAAAGAAAGCGGGTTACAGATTTGTAGGCAGCTGCAACACGGACCCCAAGCCGTTGTGTGTGTATAAGAGGTAGGAC[A/C]
GTGTATTAATGGTGTAGTATATTTTTATAGGTAACTATTGCATGAATGAGTTATTAGATTAGCTATAGATGATTTGGAGCTAATATTTGGCTATACTATT

Reverse complement sequence

AATAGTATAGCCAAATATTAGCTCCAAATCATCTATAGCTAATCTAATAACTCATTCATGCAATAGTTACCTATAAAAATATACTACACCATTAATACAC[T/G]
GTCCTACCTCTTATACACACACAACGGCTTGGGGTCCGTGTTGCAGCTGCCTACAAATCTGTAACCCGCTTTCTTTTCTCTCTTCTCTTTTCTTCTCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.10% 13.90% 0.36% 64.73% NA
All Indica  2759 2.80% 1.30% 0.58% 95.36% NA
All Japonica  1512 58.30% 40.00% 0.00% 1.65% NA
Aus  269 0.00% 0.40% 0.00% 99.63% NA
Indica I  595 0.30% 1.20% 0.17% 98.32% NA
Indica II  465 3.40% 1.70% 0.43% 94.41% NA
Indica III  913 2.80% 0.70% 0.55% 95.95% NA
Indica Intermediate  786 4.20% 1.80% 1.02% 93.00% NA
Temperate Japonica  767 45.60% 52.40% 0.00% 1.96% NA
Tropical Japonica  504 88.30% 11.70% 0.00% 0.00% NA
Japonica Intermediate  241 36.10% 59.80% 0.00% 4.15% NA
VI/Aromatic  96 9.40% 0.00% 1.04% 89.58% NA
Intermediate  90 30.00% 15.60% 0.00% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719725023 A -> DEL N N silent_mutation Average:10.682; most accessible tissue: Callus, score: 56.204 N N N N
vg0719725023 A -> C LOC_Os07g33010.1 upstream_gene_variant ; 1409.0bp to feature; MODIFIER silent_mutation Average:10.682; most accessible tissue: Callus, score: 56.204 N N N N
vg0719725023 A -> C LOC_Os07g33020.1 upstream_gene_variant ; 2283.0bp to feature; MODIFIER silent_mutation Average:10.682; most accessible tissue: Callus, score: 56.204 N N N N
vg0719725023 A -> C LOC_Os07g33010-LOC_Os07g33020 intergenic_region ; MODIFIER silent_mutation Average:10.682; most accessible tissue: Callus, score: 56.204 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719725023 6.19E-06 NA Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719725023 NA 7.53E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 2.66E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 2.30E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 6.58E-06 NA mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 2.34E-06 NA mr1076_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 5.49E-06 NA mr1082_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 1.16E-06 NA mr1085_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 7.96E-06 7.95E-06 mr1126_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 6.14E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 2.84E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 7.28E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 3.01E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 2.81E-06 4.60E-07 mr1404_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 1.85E-06 1.25E-07 mr1620_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 9.55E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 2.95E-06 2.95E-06 mr1765_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719725023 NA 1.21E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251