\
| Variant ID: vg0719534510 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19534510 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 195. )
CGAACTCAAAAGTTCTTCGTCTCGTTGATTGGATAAAACTCCAACTACATGTAATAATAATCTACGTAAAAGAGATGCAAAGTCTAATAATAGTAAACCG[T/A]
ACTATTCAAGTGTAATATTCGGAGTACAGTTTGGGCATTGTCCATGCTAAAGTATTCAATTTGAGGTAGCTTGCATTGCAGTACTGCGTACAATCTGAAT
ATTCAGATTGTACGCAGTACTGCAATGCAAGCTACCTCAAATTGAATACTTTAGCATGGACAATGCCCAAACTGTACTCCGAATATTACACTTGAATAGT[A/T]
CGGTTTACTATTATTAGACTTTGCATCTCTTTTACGTAGATTATTATTACATGTAGTTGGAGTTTTATCCAATCAACGAGACGAAGAACTTTTGAGTTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 43.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 19.30% | 80.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.60% | 31.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719534510 | T -> A | LOC_Os07g32710.1 | 3_prime_UTR_variant ; 264.0bp to feature; MODIFIER | silent_mutation | Average:71.081; most accessible tissue: Callus, score: 79.965 | N | N | N | N |
| vg0719534510 | T -> A | LOC_Os07g32700.1 | downstream_gene_variant ; 4148.0bp to feature; MODIFIER | silent_mutation | Average:71.081; most accessible tissue: Callus, score: 79.965 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719534510 | 6.85E-07 | 7.40E-08 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | 3.55E-06 | NA | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 3.61E-33 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | 7.46E-06 | 5.55E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 1.02E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 1.44E-11 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 4.58E-14 | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | 4.01E-06 | NA | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | 2.54E-06 | NA | mr1088_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 4.44E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 4.63E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 2.90E-23 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 5.13E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | 9.94E-06 | NA | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719534510 | NA | 3.73E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |