Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719511488:

Variant ID: vg0719511488 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19511488
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TACAAACTAGATGTATACGTCCTTAACTAATGCACAGACCAGAACTTTCTTCGTAAGAAAAAGAGAGAGAATCCATTATATGCCAGCGAGTTTGTCACAA[G/A,C]
TCTATGATTTACCACTGACTTTGTCACGTTCTATAATATAACATCGACTTTTGCTTAACTTCTACGATTTACCATCGACGTCCGGTTAGCCTCCGATAGT

Reverse complement sequence

ACTATCGGAGGCTAACCGGACGTCGATGGTAAATCGTAGAAGTTAAGCAAAAGTCGATGTTATATTATAGAACGTGACAAAGTCAGTGGTAAATCATAGA[C/T,G]
TTGTGACAAACTCGCTGGCATATAATGGATTCTCTCTCTTTTTCTTACGAAGAAAGTTCTGGTCTGTGCATTAGTTAAGGACGTATACATCTAGTTTGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	13.40%	0.57%	0.00%	C: 0.02%
All Indica	2759	79.10%	20.10%	0.83%	0.00%	NA
All Japonica	1512	99.40%	0.30%	0.20%	0.00%	C: 0.07%
Aus	269	75.50%	24.50%	0.00%	0.00%	NA
Indica I	595	86.60%	10.80%	2.69%	0.00%	NA
Indica II	465	85.40%	14.40%	0.22%	0.00%	NA
Indica III	913	75.00%	24.80%	0.22%	0.00%	NA
Indica Intermediate	786	74.30%	25.20%	0.51%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.00%	C: 0.41%
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719511488	G -> A	LOC_Os07g32680.1	upstream_gene_variant ; 3402.0bp to feature; MODIFIER	silent_mutation	Average:33.715; most accessible tissue: Callus, score: 63.86	N	N	N	N
vg0719511488	G -> A	LOC_Os07g32670-LOC_Os07g32680	intergenic_region ; MODIFIER	silent_mutation	Average:33.715; most accessible tissue: Callus, score: 63.86	N	N	N	N
vg0719511488	G -> C	LOC_Os07g32680.1	upstream_gene_variant ; 3402.0bp to feature; MODIFIER	silent_mutation	Average:33.715; most accessible tissue: Callus, score: 63.86	N	N	N	N
vg0719511488	G -> C	LOC_Os07g32670-LOC_Os07g32680	intergenic_region ; MODIFIER	silent_mutation	Average:33.715; most accessible tissue: Callus, score: 63.86	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719511488	6.55E-06	NA	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	4.36E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	3.67E-06	NA	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	8.09E-07	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	4.83E-06	4.82E-06	mr1046_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	9.69E-07	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	3.63E-08	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	3.66E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	9.16E-06	mr1283_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	8.61E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	7.83E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	2.40E-06	NA	mr1423_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	6.17E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	8.86E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	1.64E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	6.40E-07	9.92E-13	mr1844_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488	NA	7.55E-07	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251