\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719511488:

Variant ID: vg0719511488 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19511488
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TACAAACTAGATGTATACGTCCTTAACTAATGCACAGACCAGAACTTTCTTCGTAAGAAAAAGAGAGAGAATCCATTATATGCCAGCGAGTTTGTCACAA[G/A,C]
TCTATGATTTACCACTGACTTTGTCACGTTCTATAATATAACATCGACTTTTGCTTAACTTCTACGATTTACCATCGACGTCCGGTTAGCCTCCGATAGT

Reverse complement sequence

ACTATCGGAGGCTAACCGGACGTCGATGGTAAATCGTAGAAGTTAAGCAAAAGTCGATGTTATATTATAGAACGTGACAAAGTCAGTGGTAAATCATAGA[C/T,G]
TTGTGACAAACTCGCTGGCATATAATGGATTCTCTCTCTTTTTCTTACGAAGAAAGTTCTGGTCTGTGCATTAGTTAAGGACGTATACATCTAGTTTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 13.40% 0.57% 0.00% C: 0.02%
All Indica  2759 79.10% 20.10% 0.83% 0.00% NA
All Japonica  1512 99.40% 0.30% 0.20% 0.00% C: 0.07%
Aus  269 75.50% 24.50% 0.00% 0.00% NA
Indica I  595 86.60% 10.80% 2.69% 0.00% NA
Indica II  465 85.40% 14.40% 0.22% 0.00% NA
Indica III  913 75.00% 24.80% 0.22% 0.00% NA
Indica Intermediate  786 74.30% 25.20% 0.51% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.00% C: 0.41%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719511488 G -> A LOC_Os07g32680.1 upstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:33.715; most accessible tissue: Callus, score: 63.86 N N N N
vg0719511488 G -> A LOC_Os07g32670-LOC_Os07g32680 intergenic_region ; MODIFIER silent_mutation Average:33.715; most accessible tissue: Callus, score: 63.86 N N N N
vg0719511488 G -> C LOC_Os07g32680.1 upstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:33.715; most accessible tissue: Callus, score: 63.86 N N N N
vg0719511488 G -> C LOC_Os07g32670-LOC_Os07g32680 intergenic_region ; MODIFIER silent_mutation Average:33.715; most accessible tissue: Callus, score: 63.86 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719511488 6.55E-06 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 4.36E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 3.67E-06 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 8.09E-07 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 4.83E-06 4.82E-06 mr1046_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 9.69E-07 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 3.63E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 3.66E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 9.16E-06 mr1283_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 8.61E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 7.83E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 2.40E-06 NA mr1423_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 6.17E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 8.86E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 1.64E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 6.40E-07 9.92E-13 mr1844_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719511488 NA 7.55E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251