\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719475676:

Variant ID: vg0719475676 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19475676
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGTACAGCAGAAGCTTGTAAAGTCACCTTAGATAACAAATCAGCAGAGTAGGGATCAGACAGATATCCTTCTTGGACTTCAGTTAACCAGTCAGGTA[T/C]
ACATACTGACAAAGCACATGCTTGAATGTGATCATCAGTTGAGCAACGAGACAAAGCATCTGCAGCTCTATTATCTAACCCACGCTTGTAGACTAACCGA

Reverse complement sequence

TCGGTTAGTCTACAAGCGTGGGTTAGATAATAGAGCTGCAGATGCTTTGTCTCGTTGCTCAACTGATGATCACATTCAAGCATGTGCTTTGTCAGTATGT[A/G]
TACCTGACTGGTTAACTGAAGTCCAAGAAGGATATCTGTCTGATCCCTACTCTGCTGATTTGTTATCTAAGGTGACTTTACAAGCTTCTGCTGTACCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.20% 5.80% 1.69% 74.33% NA
All Indica  2759 1.20% 9.30% 0.65% 88.84% NA
All Japonica  1512 52.90% 0.30% 3.64% 43.19% NA
Aus  269 0.40% 0.40% 0.00% 99.26% NA
Indica I  595 0.70% 7.20% 0.34% 91.76% NA
Indica II  465 1.70% 15.30% 1.51% 81.51% NA
Indica III  913 0.20% 5.60% 0.33% 93.87% NA
Indica Intermediate  786 2.40% 11.70% 0.76% 85.11% NA
Temperate Japonica  767 75.60% 0.30% 5.08% 19.04% NA
Tropical Japonica  504 18.30% 0.20% 2.78% 78.77% NA
Japonica Intermediate  241 53.10% 0.40% 0.83% 45.64% NA
VI/Aromatic  96 9.40% 2.10% 2.08% 86.46% NA
Intermediate  90 16.70% 12.20% 5.56% 65.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719475676 T -> DEL LOC_Os07g32650.1 N frameshift_variant Average:13.742; most accessible tissue: Callus, score: 84.126 N N N N
vg0719475676 T -> C LOC_Os07g32650.1 missense_variant ; p.Ile404Val; MODERATE nonsynonymous_codon ; I404V Average:13.742; most accessible tissue: Callus, score: 84.126 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719475676 3.59E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 1.22E-06 NA mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 9.20E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 2.04E-06 NA mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 4.61E-07 NA mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 3.78E-08 6.27E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 8.62E-08 NA mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 6.75E-07 NA mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 7.26E-07 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 2.23E-06 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 2.85E-07 1.44E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 1.96E-07 NA mr1226 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 9.87E-07 NA mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 6.45E-07 NA mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 3.71E-06 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 1.10E-06 1.74E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 9.58E-06 NA mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 6.38E-06 NA mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 2.38E-06 NA mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676 1.28E-06 NA mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251