Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719475676:

Variant ID: vg0719475676 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19475676
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGTACAGCAGAAGCTTGTAAAGTCACCTTAGATAACAAATCAGCAGAGTAGGGATCAGACAGATATCCTTCTTGGACTTCAGTTAACCAGTCAGGTA[T/C]
ACATACTGACAAAGCACATGCTTGAATGTGATCATCAGTTGAGCAACGAGACAAAGCATCTGCAGCTCTATTATCTAACCCACGCTTGTAGACTAACCGA

Reverse complement sequence

TCGGTTAGTCTACAAGCGTGGGTTAGATAATAGAGCTGCAGATGCTTTGTCTCGTTGCTCAACTGATGATCACATTCAAGCATGTGCTTTGTCAGTATGT[A/G]
TACCTGACTGGTTAACTGAAGTCCAAGAAGGATATCTGTCTGATCCCTACTCTGCTGATTTGTTATCTAAGGTGACTTTACAAGCTTCTGCTGTACCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.20%	5.80%	1.69%	74.33%	NA
All Indica	2759	1.20%	9.30%	0.65%	88.84%	NA
All Japonica	1512	52.90%	0.30%	3.64%	43.19%	NA
Aus	269	0.40%	0.40%	0.00%	99.26%	NA
Indica I	595	0.70%	7.20%	0.34%	91.76%	NA
Indica II	465	1.70%	15.30%	1.51%	81.51%	NA
Indica III	913	0.20%	5.60%	0.33%	93.87%	NA
Indica Intermediate	786	2.40%	11.70%	0.76%	85.11%	NA
Temperate Japonica	767	75.60%	0.30%	5.08%	19.04%	NA
Tropical Japonica	504	18.30%	0.20%	2.78%	78.77%	NA
Japonica Intermediate	241	53.10%	0.40%	0.83%	45.64%	NA
VI/Aromatic	96	9.40%	2.10%	2.08%	86.46%	NA
Intermediate	90	16.70%	12.20%	5.56%	65.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719475676	T -> DEL	LOC_Os07g32650.1	N	frameshift_variant	Average:13.742; most accessible tissue: Callus, score: 84.126	N	N	N	N
vg0719475676	T -> C	LOC_Os07g32650.1	missense_variant ; p.Ile404Val; MODERATE	nonsynonymous_codon ; I404V	Average:13.742; most accessible tissue: Callus, score: 84.126	unknown	unknown	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719475676	3.59E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	1.22E-06	NA	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	9.20E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	2.04E-06	NA	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	4.61E-07	NA	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	3.78E-08	6.27E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	8.62E-08	NA	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	6.75E-07	NA	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	7.26E-07	NA	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	2.23E-06	NA	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	2.85E-07	1.44E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	1.96E-07	NA	mr1226	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	9.87E-07	NA	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	6.45E-07	NA	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	3.71E-06	NA	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	1.10E-06	1.74E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	9.58E-06	NA	mr1264	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	6.38E-06	NA	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	2.38E-06	NA	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719475676	1.28E-06	NA	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251