Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719453364:

Variant ID: vg0719453364 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19453364
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTCATCAGTGACGTGTCGTAACTATCTGACCGTCACTGATGACTCATCTCTGACGGGTTGTAACTTACGACCCGTCACTGATGACAAAGCAAGAAATA[C/T,A]
AATTTTTGAATTTTAAACGCAACAAAAAAACCTCAAAAAAATATTTTCAATTTTACTAGCCTTCCTATACATGGTTACACATCACTACCTACAAATTCAT

Reverse complement sequence

ATGAATTTGTAGGTAGTGATGTGTAACCATGTATAGGAAGGCTAGTAAAATTGAAAATATTTTTTTGAGGTTTTTTTGTTGCGTTTAAAATTCAAAAATT[G/A,T]
TATTTCTTGCTTTGTCATCAGTGACGGGTCGTAAGTTACAACCCGTCAGAGATGAGTCATCAGTGACGGTCAGATAGTTACGACACGTCACTGATGACTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.08%	0.00%	NA
All Indica	2759	93.40%	6.50%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.60%	6.10%	0.34%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	94.70%	5.30%	0.00%	0.00%	NA
Indica Intermediate	786	90.10%	9.80%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719453364	C -> A	LOC_Os07g32620.1	downstream_gene_variant ; 1127.0bp to feature; MODIFIER	N	Average:28.977; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0719453364	C -> A	LOC_Os07g32610-LOC_Os07g32620	intergenic_region ; MODIFIER	N	Average:28.977; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0719453364	C -> T	LOC_Os07g32620.1	downstream_gene_variant ; 1127.0bp to feature; MODIFIER	silent_mutation	Average:28.977; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N
vg0719453364	C -> T	LOC_Os07g32610-LOC_Os07g32620	intergenic_region ; MODIFIER	silent_mutation	Average:28.977; most accessible tissue: Minghui63 root, score: 63.193	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719453364	NA	8.98E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	1.66E-10	1.88E-11	mr1088	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	NA	3.37E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	7.20E-07	NA	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	9.22E-07	2.77E-08	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	3.84E-07	6.98E-09	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	1.60E-06	2.74E-06	mr1233	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	NA	3.18E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	2.51E-07	2.12E-08	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	1.28E-07	2.03E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	NA	4.51E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	3.10E-06	1.03E-06	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	NA	2.55E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719453364	NA	9.33E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251